BBS4 (NM_001252678) Human Untagged Clone

CAT#: SC332212

BBS4 (untagged) - Homo sapiens Bardet-Biedl syndrome 4 (BBS4), transcript variant 2



  "NM_001252678" in other vectors (2)

CNY 3330.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
BBS4 mouse monoclonal antibody, clone OTI2D5 (formerly 2D5)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC332212 representing NM_001252678.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCTGGGGAAGATCCACTTGCTGGAGGGAGACTTGGACAAGGCCATTGAAGTCTACAAGAAAGCAGTG
GAGTTCTCACCAGAAAATACAGAGCTTCTTACAACTTTAGGATTACTCTACTTACAGCTCGGCATTTAC
CAGAAGGCATTTGAACATCTTGGCAATGCACTGACTTATGACCCTACCAACTACAAGGCCATCTTGGCA
GCAGGCAGCATGATGCAGACCCACGGGGACTTTGATGTTGCCCTCACCAAATACAGAGTTGTGGCTTGT
GCTGTTCCAGAAAGTCCTCCACTCTGGAATAACATTGGAATGTGTTTCTTTGGCAAGAAGAAATATGTG
GCGGCCATCAGCTGCCTGAAACGAGCCAACTACTTGGCACCCTTCGATTGGAAGATTCTGTATAATTTG
GGCCTTGTCCATTTGACCATGCAGCAGTATGCATCAGCTTTTCATTTTCTCAGTGCGGCCATCAACTTC
CAGCCAAAGATGGGGGAGCTCTACATGCTCTTGGCAGTGGCTCTGACCAATCTGGAAGATATAGAAAAT
GCCAAGAGAGCCTACGCAGAAGCAGTCCACCTGGATAAGTGTAACCCTTTAGTAAACCTGAACTATGCT
GTGCTGCTGTACAACCAGGGCGAGAAGAAGAACGCCCTGGCCCAATATCAGGAGATGGAGAAGAAAGTC
AGCCTACTCAAGGACAATAGCTCTCTGGAATTTGACTCTGAGATGGTGGAGATGGCTCAGAAGTTGGGA
GCTGCTCTCCAGGTTGGGGAGGCACTGGTCTGGACCAAACCAGTTAAAGATCCCAAATCAAAGCACCAG
ACCACTTCAACCAGCAAACCTGCCAGTTTCCAGCAGCCTCTGGGCTCTAATCAAGCTCTAGGACAGGCA
ATGTCTTCAGCAGCTGCATACAGGACGCTCCCCTCAGGTGCTGGAGGAACATCCCAGTTCACAAAGCCC
CCATCTCTTCCTCTGGAGCCAGAGCCTGCGGTGGAATCAAGTCCAACTGAAACATCAGAACAAATAAGA
GAGAAATAA

Restriction Sites SgfI-MluI     
ACCN NM_001252678
Insert Size 1044 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001252678.1
RefSeq Size 2468 bp
RefSeq ORF 1044 bp
Locus ID 585
UniProt ID Q96RK4
MW 38.3 kDa
Gene Summary This gene is a member of the Bardet-Biedl syndrome (BBS) gene family. Bardet-Biedl syndrome is an autosomal recessive disorder characterized by severe pigmentary retinopathy, obesity, polydactyly, renal malformation and cognitive disability. The proteins encoded by BBS gene family members are structurally diverse. The similar phenotypes exhibited by mutations in BBS gene family members are likely due to the protein's shared roles in cilia formation and function. Many BBS proteins localize to the basal bodies, ciliary axonemes, and pericentriolar regions of cells. BBS proteins may also be involved in intracellular trafficking via microtubule-related transport. The protein encoded by this gene has sequence similarity to O-linked N-acetylglucosamine (O-GlcNAc) transferases in plants and archaebacteria and in human forms a multi-protein "BBSome" complex with seven other BBS proteins. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Transcript Variant: This variant (2) lacks an internal exon and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...