MEST (NM_001253900) Human Untagged Clone

CAT#: SC332250

MEST (untagged) - Homo sapiens mesoderm specific transcript (MEST), transcript variant 4



  "NM_001253900" in other vectors (2)

CNY 3140.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


MEST rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PEG1
Vector pCMV6-Entry
Sequence Data
>SC332250 representing NM_001253900.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTGCGCCGAGATCGCCTCCGCAGGATGAGGGAGTGGTGGGTCCAGGTGGGGCTGCTGGCCGTGCCC
CTGCTTGCTGCGTACCTGCACATCCCACCCCCTCAGCTCTCCCCTGCCCTTCACTCATGGAAGTCTTCA
GACTCTGTGGGTGTGGTTGGAAGTCCAGAGATAGTTGTGCTTTTACACGGTTTTCCAACATCCAGCTAC
GACTGGTACAAGATTTGGGAAGGTCTGACCTTGAGGTTTCATCGGGTGATTGCCCTTGATTTCTTAGGC
TTTGGCTTCAGTGACAAACCGAGACCACATCACTATTCCATATTTGAGCAGGCCAGCATCGTGGAAGCG
CTTTTGCGGCATCTGGGGCTCCAGAACCGCAGGATCAACCTTCTTTCTCATGACTATGGAGATATTGTT
GCTCAGGAGCTTCTCTACAGGTACAAGCAGAATCGATCTGGTCGGCTTACCATAAAGAGTCTCTGTCTG
TCAAATGGAGGTATCTTTCCTGAGACTCACCGTCCACTCCTTCTCCAAAAGCTACTCAAAGATGGAGGT
GTGCTGTCACCCATCCTCACACGACTGATGAACTTCTTTGTATTCTCTCGAGGTCTCACCCCAGTCTTT
GGGCCGTATACTCGGCCCTCTGAGAGTGAGCTGTGGGACATGTGGGCAGGGATCCGCAACAATGACGGG
AACTTAGTCATTGACAGTCTCTTACAGTACATCAATCAGAGGAAGAAGTTCAGAAGGCGCTGGGTGGGA
GCTCTTGCCTCTGTAACTATCCCCATTCATTTTATCTATGGGCCATTGGATCCTGTAAATCCCTATCCA
GAGTTTTTGGAGCTGTACAGGAAAACGCTGCCGCGGTCCACAGTGTCGATTCTGGATGACCACATTAGC
CACTATCCACAGCTAGAGGATCCCATGGGCTTCTTGAATGCATATATGGGCTTCATCAACTCCTTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001253900
Insert Size 966 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001253900.1
RefSeq Size 2471 bp
RefSeq ORF 966 bp
Locus ID 4232
UniProt ID Q5EB52
Protein Families Protease, Transmembrane
MW 37.1 kDa
Gene Summary This gene encodes a member of the alpha/beta hydrolase superfamily. It is imprinted, exhibiting preferential expression from the paternal allele in fetal tissues, and isoform-specific imprinting in lymphocytes. The loss of imprinting of this gene has been linked to certain types of cancer and may be due to promotor switching. The encoded protein may play a role in development. Alternatively spliced transcript variants encoding multiple isoforms have been identified for this gene. Pseudogenes of this gene are located on the short arm of chromosomes 3 and 4, and the long arm of chromosomes 6 and 15. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (4) uses an alternate splice site in the 5' coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (c) is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...