EB2 (MAPRE2) (NM_001256420) Human Untagged Clone
CAT#: SC332378
MAPRE2 (untagged) - Homo sapiens microtubule-associated protein, RP/EB family, member 2 (MAPRE2), transcript variant 4
CNY 2950.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CSCSC2; EB1; EB2; RP1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC332378 representing NM_001256420.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCGAGAACAACAACGACATCATCCAGGATAATAACGGGACCATCATTCCTTTCCGGAAGCACACAG TGCGCGGGGAGCGTTCCTACAGGAGCGGCCTATTGCCAATTCATGGACATGCTCTTCCCTGGCTGCATT AGTTTGAAGAAAGTAAAATTTCAAGCAAAGCTGGAACATGAATATATTCACAATTTTAAACTTCTGCAA GCATCATTTAAGCGAATGAACGTTGATAAGGTAATTCCAGTGGAGAAGCTAGTGAAAGGACGTTTCCAG GACAACCTGGATTTTATTCAATGGTTTAAGAAATTCTATGATGCTAACTACGATGGGAAGGAGTATGAT CCTGTAGAGGCACGACAAGGGCAAGATGCAATTCCTCCTCCTGACCCTGGTGAACAGATCTTCAACCTG CCAAAAAAGTCTCACCATGCAAACTCCCCCACAGCAGGTGCAGCTAAATCAAGTCCAGCAGCTAAACCA GGATCCACACCTTCTCGACCCTCATCAGCCAAAAGGGCTTCTTCCAGTGGCTCAGCATCCAAATCCGAT AAAGATTTAGAAACGCAGGTCATACAGCTTAATGAACAGGTACATTCATTAAAACTTGCCCTTGAAGGC GTGGAAAAGGAAAGGGATTTCTACTTTGGGAAGTTGAGAGAGATCGAGCTACTCTGCCAAGAACACGGG CAGGAAAATGATGACCTCGTGCAGAGACTAATGGACATCCTGTATGCTTCAGAAGAACACGAGGGCCAC ACAGAAGAGCCGGAAGCAGAGGAGCAAGCCCACGAACAGCAGCCCCCGCAGCAGGAAGAGTACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001256420 |
Insert Size | 825 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001256420.1 |
RefSeq Size | 4151 bp |
RefSeq ORF | 825 bp |
Locus ID | 10982 |
UniProt ID | Q15555 |
Protein Families | Druggable Genome |
MW | 30.7 kDa |
Gene Summary | The protein encoded by this gene shares significant homology to the adenomatous polyposis coli (APC) protein-binding EB1 gene family. This protein is a microtubule-associated protein that is necessary for spindle symmetry during mitosis. It is thought to play a role in the tumorigenesis of colorectal cancers and the proliferative control of normal cells. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012] Transcript Variant: This variant (4) lacks an alternate exon in the 5' coding region and uses an alternate start codon, compared to variant 1. The encoded isoform (4) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233613 | MAPRE2 (Myc-DDK tagged) - Homo sapiens microtubule-associated protein, RP/EB family, member 2 (MAPRE2), transcript variant 4 |
CNY 3990.00 |
|
RG233613 | MAPRE2 (tGFP-tagged) - Homo sapiens microtubule-associated protein, RP/EB family, member 2 (MAPRE2), transcript variant 4 |
CNY 4370.00 |