IL15RA (NM_001256765) Human Untagged Clone

CAT#: SC332470

IL15RA (untagged) - Homo sapiens interleukin 15 receptor, alpha (IL15RA), transcript variant 4



  "NM_001256765" in other vectors (2)

CNY 3420.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
IL15RA mouse monoclonal antibody,clone OTI7F4
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD215
Vector pCMV6-Entry
Sequence Data
>SC332470 representing NM_001256765.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCGACTGGCGGGGCGGCAGGTCCCAGAGCAGCGCTCGCCACCTCCCCCCGGCCTGGGCAGCGCTCGC
CCGGGGAGTCCAGCGGTGTCCTGTGGAGCTGCCGCCATGGCCCCGCGGCGGGCGCGCGGCTGCCGGACC
CTCGGTCTCCCGGCGCTGCTACTGCTGCTGCTGCTCCGGCCGCCGGCGACGCGGGATGCAAGAGACAGG
CTGGCTGTCCTGGCGGGAAGGAGCAGAATATCTGAAAGCTTCAACCATGAGGTCCAGACACACGAGGCC
TGCGTGAGACTCAGGACAATGGAAAACTGCCCCCAGTGCCACCACCATCGGACAAGCAGGCAGCAAGCA
GGCATCACGTGCCCTCCCCCCATGTCCGTGGAACACGCAGACATCTGGGTCAAGAGCTACAGCTTGTAC
TCCAGGGAGCGGTACATTTGTAACTCTGGTTTCAAGCGTAAAGCCGGCACGTCCAGCCTGACGGAGTGC
GTGTTGAACAAGGCCACGAATGTCGCCCACTGGACAACCCCCAGTCTCAAATGCATTAGAGACCCTGCC
CTGGTTCACCAAAGGCCAGCGCCACCCTCCACAGTAACGACGGCAGGGGTGACCCCACAGCCAGAGAGC
CTCTCCCCTTCTGGAAAAGAGCCCGCAGCTTCATCTCCCAGCTCAAACAACACAGCGGCCACAACAGCA
GCTATTGTCCCGGGCTCCCAGCTGATGCCTTCAAAATCACCTTCCACAGGAACCACAGAGATAAGCAGT
CATGAGTCCTCCCACGGCACCCCCTCTCAGACAACAGCCAAGAACTGGGAACTCACAGCATCCGCCTCC
CACCAGCCGCCAGGTGTGTATCCACAGGGCCACAGCGACACCACTGTGGCTATCTCCACGTCCACTGTC
CTGCTGTGTGGGCTGAGCGCTGTGTCTCTCCTGGCATGCTACCTCAAGTCAAGGCAAACTCCCCCGCTG
GCCAGCGTTGAAATGGAAGCCATGGAGGCTCTGCCGGTGACTTGGGGGACCAGCAGCAGAGATGAAGAC
TTGGAAAACTGCTCTCACCACCTATGA

Restriction Sites SgfI-MluI     
ACCN NM_001256765
Insert Size 1062 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001256765.1
RefSeq Size 1810 bp
RefSeq ORF 1062 bp
Locus ID 3601
UniProt ID Q13261
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway
MW 37.6 kDa
Gene Summary This gene encodes a cytokine receptor that specifically binds interleukin 15 (IL15) with high affinity. The receptors of IL15 and IL2 share two subunits, IL2R beta and IL2R gamma. This forms the basis of many overlapping biological activities of IL15 and IL2. The protein encoded by this gene is structurally related to IL2R alpha, an additional IL2-specific alpha subunit necessary for high affinity IL2 binding. Unlike IL2RA, IL15RA is capable of binding IL15 with high affinity independent of other subunits, which suggests distinct roles between IL15 and IL2. This receptor is reported to enhance cell proliferation and expression of apoptosis inhibitor BCL2L1/BCL2-XL and BCL2. Multiple alternatively spliced transcript variants of this gene have been reported.[provided by RefSeq, Apr 2010]
Transcript Variant: This variant (4) represents the longest transcript and encodes the longest isoform (4).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...