PCGF5 (NM_001257101) Human Untagged Clone

CAT#: SC332502

PCGF5 (untagged) - Homo sapiens polycomb group ring finger 5 (PCGF5), transcript variant 4



  "NM_001257101" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-PCGF5 Antibody
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RNF159
Vector pCMV6-Entry
Sequence Data
>SC332502 representing NM_001257101.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTACCCAAAGGAAACACTTGGTGAAAGATTTTAATCCTTACATTACCTGCTATATCTGTAAAGGG
TATCTGATCAAGCCAACAACAGTGACGGAATGCCTCCATACATTCTGTAAGACTTGTATTGTTCAGCAC
TTTGAAGATAGCAATGATTGCCCAAGGTGTGGCAACCAAGTTCATGAGACAAATCCATTAGAAATGTTG
AGGTTGGACAATACATTAGAGGAAATTATATTTAAGCTGGTCCCTGGACTACGAGAACAAGAACTTGAG
CGTGAATCTGAATTTTGGAAGAAAAATAAGCCTCAAGAAAATGGACAAGATGATACTTCAAAAGCTGAC
AAACCGAAAGTAGATGAAGAAGGTGATGAAAATGAAGATGATAAAGATTATCACAGAAGTGACCCACAA
ATTGCTATCTGTCTAGATTGTTTACGAAATAATGGGCAATCAGGGGACAATGTAGTAAAGGGTTTAATG
AAGAAATTCATTCGATGTTCTACACGTGTAACTGTGGGAACTATTAAAAAATTTCTAAGTTTAAAACTA
AAACTTCCAAGTTCTTATGAGTTGGATGTGCTGTGCAATGGTGAAATTATGGGGAAGGATCATACTATG
GAATTCATCTACATGACAAGATGGCGACTAAGAGGCGAAAACTTTCGGTGTCTGAACTGCTCAGCTTCG
CAAGTCTGCTCTCAGGATGGCCCTTTGTATCAGTCATACCCTATGGTACTGCAGTATCGACCAAGAATT
GATTTCGGTTAG

Restriction Sites SgfI-MluI     
ACCN NM_001257101
Insert Size 771 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001257101.1
RefSeq Size 7057 bp
RefSeq ORF 771 bp
Locus ID 84333
UniProt ID Q86SE9
MW 29.7 kDa
Gene Summary Component of a Polycomb group (PcG) multiprotein PRC1-like complex, a complex class required to maintain the transcriptionally repressive state of many genes, including Hox genes, throughout development. PcG PRC1 complex acts via chromatin remodeling and modification of histones; it mediates monoubiquitination of histone H2A 'Lys-119', rendering chromatin heritably changed in its expressibility (PubMed:26151332). Within the PRC1-like complex, regulates RNF2 ubiquitin ligase activity (PubMed:26151332). Plays a redundant role with PCGF3 as part of a PRC1-like complex that mediates monoubiquitination of histone H2A 'Lys-119' on the X chromosome and is required for normal silencing of one copy of the X chromosome in XX females (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 4 all encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...