TSGA14 (CEP41) (NM_001257160) Human Untagged Clone

CAT#: SC332510

CEP41 (untagged) - Homo sapiens centrosomal protein 41kDa (CEP41), transcript variant 4



  "NM_001257160" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CEP41 Antibody - N-terminal region
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms JBTS15; TSGA14
Vector pCMV6-Entry
Sequence Data
>SC332510 representing NM_001257160.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCCCTCCGGAGGCACATTGGGAACCCTGAGTATCTGATGAAAAGGATACCACAGAACCCAAGATAC
CAGCATATCAAATCAAGACTGGACACTGGTGCCTGTGTGTATCTTACCAGCTCCCCAGCACTGCCAGAC
TGTGCCATGAATGGATTATGCTTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001257160
Insert Size 165 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001257160.1
RefSeq Size 3315 bp
RefSeq ORF 165 bp
Locus ID 95681
UniProt ID Q9BYV8
Protein Families Druggable Genome
MW 6.2 kDa
Gene Summary This gene encodes a centrosomal and microtubule-binding protein which is predicted to have two coiled-coil domains and a rhodanese domain. In human retinal pigment epithelial cells the protein localized to centrioles and cilia. Mutations in this gene have been associated with Joubert Syndrome 15; an autosomal recessive ciliopathy and neurological disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
Transcript Variant: This variant (4) lacks multiple exons in the 3' coding region and has a novel 3' terminus, compared to variant 1, which results in an isoform (4; also known as short (S) type) which has a severely truncated and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...