PHKG1 (NM_001258459) Human Untagged Clone

CAT#: SC332724

PHKG1 (untagged) - Homo sapiens phosphorylase kinase, gamma 1 (muscle) (PHKG1), transcript variant 1



  "NM_001258459" in other vectors (2)

CNY 3990.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-PHKG1 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PHKG
Vector pCMV6-Entry
Sequence Data
>SC332724 representing NM_001258459.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACCCGGGACGAGGCACTGCCGGACTCTCATTCTGCACAGGACTTCTATGAGAATTATGAGCCCAAA
GAGATCCTGGGCAGGGGCGTTAGCAGTGTGGTCAGGCGATGCATCCACAAGCCCACGAGCCAGGAGTAC
GCCGTGAAGGTCATCGACGTCACCGGTGGAGGCAGCTTCAGCCCGGAGGAGGTGCGGGAGCTGCGAGAA
GCCACGCTGAAGGAGGTGGACATCCTGCGCAAGGTCTCAGGGCACCCCAACATCATACAGCTGAAGGAC
ACTTATGAGACCAACACTTTCTTCTTCTTGGTGTTTGACCTATGGGAAGACACTGATACAATGGAGATG
GAACAGAAATGGTGCTTGGGCTGGGACTCTCCCAAGTCCACCAACTTCAGGGCCCAGGGCAGGGCAAGG
ATGAAGAGAGGGGAGCTCTTTGACTACCTCACTGAGAAGGTCACCTTGAGTGAGAAGGAAACCAGAAAG
ATCATGCGAGCTCTGCTGGAGGTGATCTGCACCTTGCACAAACTCAACATCGTGCACCGGGACCTGAAG
CCCGAGAACATTCTCTTGGATGACAACATGAACATCAAGCTCACAGACTTTGGCTTTTCCTGCCAGCTG
GAGCCGGGAGAGAGGCTGCGAGAGGTCTGCGGGACCCCCAGTTACCTGGCCCCTGAGATTATCGAGTGC
TCCATGAATGAGGACCACCCGGGCTACGGGAAAGAGGTGGACATGTGGAGCACTGGCGTCATCATGTAC
ACGCTGCTGGCCGGCTCCCCGCCCTTCTGGCACCGGAAGCAGATGCTGATGCTGAGGATGATCATGAGC
GGCAACTACCAGTTTGGCTCGCCCGAGTGGGATGATTACTCGGACACCGTGAAGGACCTGGTCTCCCGA
TTCCTGGTGGTGCAACCCCAGAACCGCTACACAGCGGAAGAGGCCTTGGCACACCCCTTCTTCCAGCAG
TACTTGGTGGAGGAAGTGCGGCACTTCAGCCCCCGGGGGAAGTTCAAGGTGATCGCTCTGACCGTGCTG
GCTTCAGTGCGGATCTACTACCAGTACCGCCGGGTGAAGCCTGTGACCCGGGAGATCGTCATCCGAGAC
CCCTATGCCCTCCGGCCTCTGCGCCGGCTCATCGACGCCTACGCTTTCCGAATCTATGGCCACTGGGTG
AAGAAGGGGCAGCAGCAGAACCGGGCAGCCCTTTTCGAGAACACACCCAAGGCCGTGCTCCTCTCCCTG
GCCGAGGAGGACTACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001258459
Insert Size 1260 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001258459.1
RefSeq Size 2226 bp
RefSeq ORF 1260 bp
Locus ID 5260
UniProt ID Q16816
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Calcium signaling pathway, Insulin signaling pathway
MW 48.9 kDa
Gene Summary This gene is a member of the Ser/Thr protein kinase family and encodes a protein with one protein kinase domain and two calmodulin-binding domains. This protein is the catalytic member of a 16 subunit protein kinase complex which contains equimolar ratios of 4 subunit types. The complex is a crucial glycogenolytic regulatory enzyme. This gene has two pseudogenes at chromosome 7q11.21 and one at chromosome 11p11.12. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...