CALCOCO2 (NM_001261395) Human Untagged Clone

CAT#: SC332755

CALCOCO2 (untagged) - Homo sapiens calcium binding and coiled-coil domain 2 (CALCOCO2), transcript variant 5



  "NM_001261395" in other vectors (2)

CNY 3610.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
CALCOCO2 mouse monoclonal antibody, clone OTI4H5 (formerly 4H5)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NDP52
Vector pCMV6-Entry
Sequence Data
>SC332755 representing NM_001261395.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTGGGTTACTTTGCCCATTGACCTAAACAACAAATCAGCTAAACAGCAGGAAGTCCAATTCAAAGCT
TACTACCTGCCCAAGGATGATGAGTATTACCAGTTCTGCTATGTGGATGAGGATGGTGTGGTCCGGGGA
GCAAGTATTCCTTTCCAATTCCGTCCAGAAAATGAGGAAGACATCCTGGTTGTTACCACTCAGGGAGAG
GTGGAAGAGATTGAGCAGCACAACAAGGAGCTTTGCAAAGAAAACCAGGAGCTGAAGGACAGCTGTATC
AGCCTCCAGAAGCAGAACTCAGACATGCAGGCTGAGCTCCAAAAGAAGCAGGAGGAGCTAGAAACCCTA
CAGAGCATCAATAAGAAGTTGGAACTGAAAGTGAAAGAACAGAAGGACTATTGGGAGACAGAGCTGCTT
CAACTGAAAGAACAAAACCAGAAGATGTCCTCAGAAAATGAGAAGATGGGAATCAGAGTGGATCAGCTT
CAGGCCCAGCTGTCAACTCAAGAGAAAGAAATGGAGAAGCTTGTTCAGGGAGATCAAGATAAGACAGAG
CAGTTAGAGCAGCTGAAAAAGGAAAATGACCACCTCTTTCTCAGTTTAACTGAACAGAGGAAGGACCAG
AAGAAGCTCGAGCAGACAGTGGAGCAAATGAAGCAGAATGAAACTACTGCAATGAAGAAACAACAGGAA
TTAATGGATGAAAACTTTGACCTGTCAAAAAGACTGAGTGAGAACGAAATTATATGTAATGCTCTGCAG
AGACAGAAAGAGAGATTGGAAGGAGAAAATGATCTTTTGAAGAGGGAGAACAGCAGATTGCTCAGTTAC
ATGGGTCTGGATTTTAATTCTTTGCCGTATCAAGTACCTACTTCAGATGAAGGAGGCGCAAGACAAAAT
CCAGGACTTGCCTATGGAAACCCATATTCTGGTATCCAAGAAAGTTCTTCCCCCAGCCCGCTCTCCATC
AAGAAATGCCCTATCTGCAAAGCAGATGATATTTGTGATCACACCTTGGAGCAACAGCAGATGCAGCCC
CTTTGTTTCAATTGTCCAATTTGTGACAAGATCTTCCCAGCTACAGAGAAGCAGATCTTTGAAGACCAC
GTGTTCTGCCACTCTCTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001261395
Insert Size 1125 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001261395.1
RefSeq Size 3492 bp
RefSeq ORF 1125 bp
Locus ID 10241
UniProt ID Q13137
MW 43.7 kDa
Gene Summary This gene encodes a coiled-coil domain-containing protein. The encoded protein functions as a receptor for ubiquitin-coated bacteria and plays an important role in innate immunity by mediating macroautophagy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
Transcript Variant: This variant (5) lacks two consecutive internal exons and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (5) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...