LAT2 (SLC7A8) (NM_001267036) Human Untagged Clone

CAT#: SC332831

SLC7A8 (untagged) - Homo sapiens solute carrier family 7 (amino acid transporter light chain, L system), member 8 (SLC7A8), transcript variant 3



  "NM_001267036" in other vectors (2)

CNY 4090.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Anti-SLC7A8 (LAT2) mouse monoclonal antibody, clone OTI5A9 (formerly 5A9)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms LAT2; LPI-PC1
Vector pCMV6-Entry
Sequence Data
>SC332831 representing NM_001267036.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGGCAGTATGGGCAGGAGCTTAGCTGGAAGTGTTTGGTAAAAGCTGTGTGCCTCCAGGAGCACTCA
CAGCCCTCACAGCTTCTCTGCACCCTCCTCCTCTGCTGGTGTGTCCTTGGAAGAGAGAGGCCCTTCCGG
AAGGCTCAGAGCACCTCCTCTCCTTTGGAGGGGGTTCCGAGATTTCTAAAACGTTTGCTCCTCACATGG
GTCAACTGTTCCAGTGTGCGGTGGGCCACCCGGGTTCAAGACATCTTCACAGCTGGGAAGCTCCTGGCC
TTGGCCCTGATTATCATCATGGGGATTGTACAGATATGCAAAGGAGAGTACTTCTGGCTGGAGCCAAAG
AATGCATTTGAGAATTTCCAGGAACCTGACATCGGCCTCGTCGCACTGGCTTTCCTTCAGGGCTCCTTT
GCCTATGGAGGCTGGAACTTTCTGAATTACGTGACTGAGGAGCTTGTTGATCCCTACAAGAACCTTCCC
AGAGCCATCTTCATCTCCATCCCACTGGTCACATTTGTGTATGTCTTTGCCAATGTCGCTTATGTCACT
GCAATGTCCCCCCAGGAGCTGCTGGCATCCAACGCCGTCGCTGTGACTTTTGGAGAGAAGCTCCTAGGA
GTCATGGCCTGGATCATGCCCATTTCTGTTGCCCTGTCCACATTTGGAGGAGTTAATGGGTCTCTCTTC
ACCTCCTCTCGGCTGTTCTTCGCTGGAGCCCGAGAGGGCCACCTTCCCAGTGTGTTGGCCATGATCCAC
GTGAAGCGCTGCACCCCAATCCCAGCCCTGCTCTTCACATGCATCTCCACCCTGCTGATGCTGGTCACC
AGCGACATGTACACACTCATCAACTATGTGGGCTTCATCAACTACCTCTTCTATGGGGTCACGGTTGCT
GGACAGATAGTCCTTCGCTGGAAGAAGCCTGATATCCCCCGCCCCATCAAGATCAACCTGCTGTTCCCC
ATCATCTACTTGCTGTTCTGGGCCTTCCTGCTGGTCTTCAGCCTGTGGTCAGAGCCGGTGGTGTGTGGC
ATTGGCCTGGCCATCATGCTGACAGGAGTGCCTGTCTATTTCCTGGGTGTTTACTGGCAACACAAGCCC
AAGTGTTTCAGTGACTTCATTGAGCTGCTAACCCTGGTGAGCCAGAAGATGTGTGTGGTCGTGTACCCC
GAGGTGGAGCGGGGCTCAGGGACAGAGGAGGCTAATGAGGACATGGAGGAGCAGCAGCAGCCCATGTAC
CAACCCACTCCCACGAAGGACAAGGACGTGGCGGGGCAGCCCCAGCCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001267036
Insert Size 1293 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001267036.1
RefSeq Size 3296 bp
RefSeq ORF 1293 bp
Locus ID 23428
UniProt ID Q9UHI5
Protein Families Druggable Genome, Transmembrane
MW 48.3 kDa
Gene Summary Sodium-independent, high-affinity transport of small and large neutral amino acids such as alanine, serine, threonine, cysteine, phenylalanine, tyrosine, leucine, arginine and tryptophan, when associated with SLC3A2/4F2hc. Acts as an amino acid exchanger. Has higher affinity for L-phenylalanine than LAT1 but lower affinity for glutamine and serine. L-alanine is transported at physiological concentrations. Plays a role in basolateral (re)absorption of neutral amino acids. Involved in the uptake of methylmercury (MeHg) when administered as the L-cysteine or D,L-homocysteine complexes, and hence plays a role in metal ion homeostasis and toxicity. Involved in the cellular activity of small molecular weight nitrosothiols, via the stereoselective transport of L-nitrosocysteine (L-CNSO) across the transmembrane. Plays an essential role in the reabsorption of neutral amino acids from the epithelial cells to the bloodstream in the kidney.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (c) is shorter and has a distinct N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...