UBE3B (NM_001270451) Human Untagged Clone

CAT#: SC332942

UBE3B (untagged) - Homo sapiens ubiquitin protein ligase E3B (UBE3B), transcript variant 6



  "NM_001270451" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
UBE3B mouse monoclonal antibody,clone OTI3F10
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BPIDS; KOS
Vector pCMV6-Entry
Sequence Data
>SC332942 representing NM_001270451.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTTCACCCTGTCTCAGACCTCGAGAGCATGGTTCATCGATAGAGCCCGTCAGGCACGAGAAGAAAGG
CTTGTGCAGAAGGAACGGGAGCGGGCAGCTGTTGTGATCCAGGCCCATGTCCGGAGTTTTCTCTGTCGG
AGTCGACTGCAGAGAGATATCAGGAGAGAGATTGATGACTTTTTTAAAGCAGATGACCCTGAGTCCACT
AAAAGAAGTGCACTTTGTATTTTCAAGATTGCCAGGAAACTGCTGTTCCTATTCAGAATCAAAGAGGAT
AATGAGAGATTTGAGAAGTTGTGTCGCAGCATCCTGAGCAGCATGGATGCTGAGAATGAGCCTAAGGTG
TGGTATGTGTCCCTGGCTTGTTCTAAGGACCTCACCCTCCTTTGGATTCAACAGATCAAGAACATTTTG
TGGTACTGCTGTGATTTTCTCAAGCAGCTCAAGCCTGAAATCCTGCAGGACTCCCGACTCATCACCCTG
TACCTCACGATGCTTGTCACCTTCACAGACACTTCAACGTGGAAAATTCTTCGGGGAAAAGGTGAAAGT
CTTCGACCAGCGATGAACCACATTTGTGCAAATATAATGGGACATCTCAACCAGCATGGATTTTATTCT
GTGCTGCAGTGCTGTGATGGGCTGTTTCCTGATTTGGTTTCATATGCTCCTCACAACAACCCTGTGAGG
TGGTCCGTTGGCAGAAGCTGGTATGACTGGCAGTTGTCTCGCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001270451
Insert Size 735 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001270451.1
RefSeq Size 1158 bp
RefSeq ORF 735 bp
Locus ID 89910
UniProt ID Q7Z3V4
Protein Families Druggable Genome
Protein Pathways Ubiquitin mediated proteolysis
MW 28.9 kDa
Gene Summary The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (6) uses an alternate splice site in the 5' UTR and contains an alternate 3' exon, compared to variant 1. These differences result in a distinct 3' UTR and 3' coding region and a protein (isoform 3) with a shorter and distinct C-terminus, compared to isoform 1. Variants 4-6 encode the same protein (isoform 3).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...