GLUT8 (SLC2A8) (NM_001271711) Human Untagged Clone

CAT#: SC333090

SLC2A8 (untagged) - Homo sapiens solute carrier family 2 (facilitated glucose transporter), member 8 (SLC2A8), transcript variant 2



  "NM_001271711" in other vectors (2)

CNY 3900.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


SLC2A8 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GLUT8; GLUTX1
Vector pCMV6-Entry
Sequence Data
>SC333090 representing NM_001271711.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACGCCCGAGGACCCAGAGGAAACCCAGCCGCTTCTGGGGCCTCCTGGCGGCAGCGCGCCCCGCGGC
CGCCGCGTCTTCCTCGCCGCCTTCGCCGCTGCCCTGGGCCCACTCAGCTTCGGCTTCGCGCTCGGCTAC
AGCTCCCCGGCCATCCCTAGCCTGCAGCGCGCCGCGCCCCCGGCCCCGCGCCTGGACGACGCCGCCGCC
TCCTGGTTCGGGGCTGTCGTGACCCTGGGTGCCGCGGCGGGGGGAGTGCTGGGCGGCTGGCTGGTGGAC
CGCGCCGGGCGCAAGCTGAGCCTCTTGCTGTGCTCCGTGCCCTTCGTGGCCGGCTTTGCCGTCATCACC
GCGGCCCAGGACGTGTGGATGCTGCTGGGGGGCCGCCTCCTCACCGGCCTGGCCTGCGGTGTTGCCTCC
CTAGTGGCCCCGGTCTACATCTCCGAAATCGCCTACCCAGCAGTCCGGGGGTTGCTCGGCTCCTGTGTG
CAGCTAATGGTCGTCGTCGGCATCCTCCTGGCCTACCTGGCAGGCTGGGTGCTGGAGTGGCGCTGGCTG
GCTGTGCTGGGCTGCGTGCCCCCCTCCCTCATGCTGCTTCTCATGTGCTTCATGCCCGAGACCCCGCGC
TTCCTGCTGACTCAGCACAGGCGCCAGGAGGCCATGGCCGCCCTGCGGTTCCTGTGGGGCTCCGAGCAG
GGCTGGGAAGACCCCCCCATCGGGGCTGAGCAGAGCTTTCACCTGGCCCTGCTGCGGCAGCCCGGCATC
TACAAGCCCTTCATCATCGGCGTCTCCCTGATGGCCTTCCAGCAGCTGTCGGGGGTCAACGCCGTCATG
TTCTATGCAGAGACCATCTTTGAAGAGGCCAAGTTCAAGGACAGCAGCCTGGCCTCGGTCGTCGTGGGT
GTCATCCAGGTGCTGTTCACAGCTGTGGCGGCTCTCATCATGGACAGAGCAGGGCGGAGGCTGCTCCTG
GTCTTGTCAGGTGTGGTCATGGTGTTCAGCACGAGTGCCTTCGGCGCCTACTTCAAGCTGACCCAGGGT
GGCCCTGGCAACTCCTCGCACGTGGCCATCTCGGCGCCTGTCTCTGCACAGCCTGTTGATGCCAGCGTG
GGGCTGGCCTGGCTGGCCGTGGGCAGCATGTGCCTCTTCATCGCCGGAGGTCCTCAGGCCCTATGGAGC
CTTCTGGCTTGCCTCCGCTTTCTGCATCTTCAGTGTCCTTTTCACTTTGTTCTGTGTCCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001271711
Insert Size 1236 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271711.1
RefSeq Size 2030 bp
RefSeq ORF 1236 bp
Locus ID 29988
UniProt ID Q9NY64
Protein Families Transmembrane
MW 43.5 kDa
Gene Summary This gene belongs to the solute carrier 2A family, which includes intracellular glucose transporters. Based on sequence comparison, the glucose transporters are grouped into three classes and this gene is a member of class II. The encoded protein, like other members of the family, contains several conserved residues and motifs and 12 transmembrane domains with both amino and carboxyl ends being on the cytosolic side of the membrane. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Nov 2012]
Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform 2 is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...