SPINK2 (NM_001271720) Human Untagged Clone

CAT#: SC333093

SPINK2 (untagged) - Homo sapiens serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor) (SPINK2), transcript variant 4



  "NM_001271720" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HUSI-II; SPGF29
Vector pCMV6-Entry
Sequence Data
>SC333093 representing NM_001271720.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGCTGTCGGTGCTGCGCTTGGCGCTGCTGCTCCTGGCAGTTACCTTCGCAGGTAGCGCTCGGAGC
GGTCCTGGCGAGCGGGGACCTCCGGAGAAAAGCGGGTTTGGGAGTCAGACCGGCGGCGGACCCTGCCCT
GCTCCGGGCGGCCTCGGCGACGCCTCTCTGATCCCTCAATTTGGTCTGTTTTCAAAATATAGAACGCCA
AACTGCTCTCAGTATAGATTACCAGGATGTCCCAGACACTTTAACCCTGTGTGTGGCAGTGACATGTCC
ACTTATGCCAATGAATGTACTCTGTGCATGAAAATCAGGGAAGGTGGTCATAATATTAAAATCATTCGA
AATGGACCCTGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001271720
Insert Size 360 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271720.1
RefSeq Size 741 bp
RefSeq ORF 360 bp
Locus ID 6691
Protein Families Secreted Protein, Transmembrane
MW 12.5 kDa
Gene Summary This gene encodes a member of the family of serine protease inhibitors of the Kazal type (SPINK). The encoded protein acts as a trypsin and acrosin inhibitor in the genital tract and is localized in the spermatozoa. The protein has been associated with the progression of lymphomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Transcript Variant: This variant (4) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. It encodes isoform 4 which is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...