SPINK2 (NM_001271721) Human Untagged Clone
CAT#: SC333094
SPINK2 (untagged) - Homo sapiens serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor) (SPINK2), transcript variant 5
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HUSI-II; SPGF29 |
Vector | pCMV6-Entry |
Sequence Data |
>SC333094 representing NM_001271721.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCGCTGTCGGTGCTGCGCTTGGCGCTGCTGCTCCTGGCAGTTACCTTCGCAGGTAGCGCTCGGAGC GGTCCTGGCGAGCGGGGACCTCCGGAGAAAAGCGGGTTTGGGAGTCAGACCGGCGGCGGACCCTGCCCT GCTCCGGGCGGCCTCGGCGACGAACGCCAAACTGCTCTCAGTATAGATTACCAGGATGTCCCAGACACT TTAACCCTGTGTGTGGCAGTGACATGTCCACTTATGCCAATGAATGTACTCTGTGCATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271721 |
Insert Size | 267 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001271721.1 |
RefSeq Size | 701 bp |
RefSeq ORF | 267 bp |
Locus ID | 6691 |
UniProt ID | P20155 |
Protein Families | Secreted Protein, Transmembrane |
MW | 8.9 kDa |
Gene Summary | This gene encodes a member of the family of serine protease inhibitors of the Kazal type (SPINK). The encoded protein acts as a trypsin and acrosin inhibitor in the genital tract and is localized in the spermatozoa. The protein has been associated with the progression of lymphomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012] Transcript Variant: This variant (5) uses two alternate splice sites in the 5' coding region which results in a frameshift and an early stop codon, compared to variant 1. It encodes isoform 5 which has a distinct C-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233249 | SPINK2 (Myc-DDK tagged) - Homo sapiens serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor) (SPINK2), transcript variant 5 |
CNY 3990.00 |
|
RG233249 | SPINK2 (tGFP-tagged) - Homo sapiens serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor) (SPINK2), transcript variant 5 |
CNY 4370.00 |