FAR2 (NM_001271784) Human Untagged Clone

CAT#: SC333110

FAR2 (untagged) - Homo sapiens fatty acyl CoA reductase 2 (FAR2), transcript variant 3



  "NM_001271784" in other vectors (2)

CNY 3990.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-FAR2 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HEL-S-81; MLSTD1; SDR10E2
Vector pCMV6-Entry
Sequence Data
>SC333110 representing NM_001271784.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCAGGAGCTTCTCTCCTGTACAAACATAATATTTCACTGTGCAGCCACTGTACGCTTTGACGACACT
CTCAGACATGCTGTGCAACTTAACGTCACTGCCACCCGGCAGCTCTTGCTTATGGCTAGTCAGATGCCA
AAGCTGGAAGCCTTTATACATATCTCTACTGCCTATTCAAATTGTAACCTGAAGCACATCGATGAAGTT
ATCTATCCGTGCCCTGTGGAGCCAAAAAAAATCATTGATTCCCTTGAGTGGTTAGACGATGCTATTATT
GACGAGATTACACCCAAGCTGATCAGAGATTGGCCCAATATTTATACCTACACCAAGGCCTTGGGAGAA
ATGGTGGTGCAGCAAGAGAGCAGGAACCTGAACATTGCCATCATAAGGCCCTCCATTGTGGGAGCAACT
TGGCAGGAGCCTTTCCCAGGTTGGGTTGATAATATAAATGGACCTAATGGAATCATTATTGCGACTGGG
AAAGGGTTTCTTCGGGCCATAAAAGCTACTCCAATGGCTGTGGCAGACGTAATTCCAGTTGATACAGTC
GTCAATCTCATGCTAGCTGTAGGATGGTATACTGCAGTTCACAGACCTAAGTCAACATTAGTCTACCAC
ATTACATCTGGTAACATGAATCCCTGCAATTGGCACAAAATGGGAGTCCAAGTCTTGGCAACCTTTGAA
AAAATCCCATTTGAGAGACCTTTCAGGAGGCCAAATGCTAATTTTACCAGCAACAGCTTCACATCACAG
TACTGGAATGCGGTCAGCCACCGGGCCCCTGCCATTATCTATGACTGCTATCTGCGGCTCACTGGAAGG
AAGCCCAGGATGACAAAGCTCATGAATCGGCTTTTAAGAACTGTTTCCATGTTGGAGTATTTCATCAAC
CGGAGTTGGGAATGGAGCACGTACAATACAGAAATGCTGATGTCTGAGCTGAGTCCTGAAGACCAGAGA
GTATTCAACTTTGACGTGCGCCAGTTGAACTGGTTGGAATACATTGAAAATTATGTTTTGGGAGTTAAA
AAATACTTATTGAAAGAGGATATGGCTGGGATCCCAAAAGCAAAGCAACGCTTAAAAAGGCTCCGAAAT
ATTCACTACCTCTTTAATACTGCCCTCTTCCTTATCGCCTGGCGCCTTCTCATTGCAAGATCTCAGATG
GCTCGGAATGTCTGGTTCTTCATTGTAAGCTTCTGTTATAAATTCCTCTCCTACTTTAGAGCATCCAGC
ACGCTCAAAGTTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001271784
Insert Size 1257 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271784.1
RefSeq Size 3478 bp
RefSeq ORF 1257 bp
Locus ID 55711
Protein Families Transmembrane
MW 48.5 kDa
Gene Summary This gene belongs to the short chain dehydrogenase/reductase superfamily. It encodes a reductase enzyme involved in the first step of wax biosynthesis wherein fatty acids are converted to fatty alcohols. The encoded peroxisomal protein utilizes saturated fatty acids of 16 or 18 carbons as preferred substrates. Alternatively spliced transcript variants have been observed for this gene. Related pseudogenes have been identified on chromosomes 2, 14 and 22. [provided by RefSeq, Nov 2012]
Transcript Variant: This variant (3) lacks an alternate exon in the 5' coding region and uses a downstream start codon compared to variant 1. It encodes isoform 2 which has a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...