DRGX (NM_001276451) Human Untagged Clone

CAT#: SC333252

DRGX (untagged) - Homo sapiens dorsal root ganglia homeobox (DRGX)



  "NM_001276451" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
DRGX mouse monoclonal antibody,clone OTI2C11
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DRG11; PRRXL1
Vector pCMV6-Entry
Sequence Data
>SC333252 representing NM_001276451.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTTTTATTTCCACTGCCCGCCACAGCTAGAGGGCACTGCAACCTTTGGCAATCACTCTTCGGGGGAT
TTTGATGACGGGTTTCTGCGTAGAAAACAGCGCCGGAACCGGACGACGTTCACTCTTCAGCAGCTGGAA
GCTCTCGAGGCCGTTTTTGCCCAAACACACTATCCAGATGTCTTCACCAGAGAAGAGCTCGCCATGAAA
ATAAACCTCACAGAAGCCAGAGTGCAGGTTTGGTTCCAGAACAGAAGGGCCAAATGGAGGAAGACAGAG
AGAGGGGCCTCAGACCAGGAGCCAGGAGCCAAGGAGCCCATGGCAGAGGTGACACCTCCTCCAGTGAGA
AACATCAACTCCCCGCCCCCTGGGGACCAAGCCCGGAGTAAGAAGGAGGCGCTGGAGGCCCAGCAGAGC
CTGGGGCGAACGGTAGGTCCTGCAGGGCCTTTCTTCCCCTCCTGCTTGCCGGGGACTCTCCTGAACACG
GCCACCTACGCCCAGGCCTTGTCCCATGTGGCTTCCCTCAAAGGGGGCCCACTGTGCTCTTGCTGCGTC
CCAGACCCCATGGGACTCTCCTTCCTTCCCACCTATGGCTGCCAGAGTAACCGCACGGCCAGCGTGGCC
ACCCTGCGCATGAAGGCCCGCGAGCACTCAGAAGCTGTCCTGCAGTCAGCCAACCTCCTGCCTTCCACC
AGCAGCAGCCCCGGCCCTGTCGCCAAGCCGGCGCCCCCAGATGGCAGCCAGGAAAAGACCTCTCCCACC
AAGGAACAGAGCGAGGCAGAGAAGAGTGTATGA

Restriction Sites SgfI-MluI     
ACCN NM_001276451
Insert Size 792 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001276451.1
RefSeq Size 955 bp
RefSeq ORF 792 bp
Locus ID 644168
UniProt ID A6NNA5
MW 28.7 kDa
Gene Summary Transcription factor required for the formation of correct projections from nociceptive sensory neurons to the dorsal horn of the spinal cord and normal perception of pain.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...