XPNPEP3 (NM_001204827) Human Untagged Clone

CAT#: SC333314

XPNPEP3 (untagged) - Human X-prolyl aminopeptidase (aminopeptidase P) 3, putative (XPNPEP3), transcript variant 2



  "NM_001204827" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
XPNPEP3 mouse monoclonal antibody, clone OTI2D5 (formerly 2D5)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms APP3; ICP55; NPHPL1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333314 representing NM_001204827.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCTTGGCTGCTCTCAGCCCCCAAGCTGGTTCCCGCTGTAGCAAACGTCCGCGGCCTCTCAGGGTCT
TACTTTGTCACCCAAGCTGGAGTGCAGTGGCGTGATCCCATTACACTGCAACCTATGTCTTCCAGGCTC
AAGCAGTCTTTCTACCAGCTTCCCGAGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001204827
Insert Size 168 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001204827.1
RefSeq Size 1462 bp
RefSeq ORF 168 bp
Locus ID 63929
Protein Families Druggable Genome, Protease
MW 6.2 kDa
Gene Summary The protein encoded by this gene belongs to the family of X-pro-aminopeptidases that utilize a metal cofactor, and remove the N-terminal amino acid from peptides with a proline residue in the penultimate position. This protein has been shown to localize to the mitochondria of renal cells, and have a role in ciliary function. Mutations in this gene are associated with nephronophthisis-like nephropathy-1. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene, however, expression of some of these isoforms in vivo is not known.[provided by RefSeq, Mar 2011]
Transcript Variant: This variant (2) shares the first exon in common with variant 1 and contains two alternate exons at the 3' end. This results in a frame-shift and a very short isoform (2) with a distinct C-terminus compared to isoform 1. This variant is supported by transcript evidence, but the encoded isoform lacks experimental support.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...