Bestrophin 3 (BEST3) (NM_001282616) Human Untagged Clone
CAT#: SC333355
BEST3 (untagged) - Human bestrophin 3 (BEST3), transcript variant 6
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
BEST3 (Bestrophin 3) mouse monoclonal antibody, clone OTI3D7 (formerly 3D7)
CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | VMD2L3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC333355 representing NM_001282616.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTTCCTCATCTCTAGCAGTGTTCACGGAAGCGACGAGCACGGGCGCCTGCTTAGAAGGACGCTGATG CGCTACGTCAATCTCACCTCCCTGCTCATCTTTCGCTCGGTGAGCACTGCTGTGTACAAAAGATTTCCC ACAATGGACCACGTGGTTGAAGCAGAAAGAACTGGCATGAAACCCATTCTGCCTTCAAGTTTTGAGATG CAGAGCTTTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282616 |
Insert Size | 219 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001282616.1 |
RefSeq Size | 1943 bp |
RefSeq ORF | 219 bp |
Locus ID | 144453 |
UniProt ID | Q8N1M1 |
Protein Families | Ion Channels: Other, Transmembrane |
MW | 8.3 kDa |
Gene Summary | BEST3 belongs to the bestrophin family of anion channels, which includes BEST1 (MIM 607854), the gene mutant in vitelliform macular dystrophy (VMD; MIM 153700), and 2 other BEST1-like genes, BEST2 (MIM 607335) and BEST4 (MIM 607336). Bestrophins are transmembrane (TM) proteins that share a homology region containing a high content of aromatic residues, including an invariant arg-phe-pro (RFP) motif. The bestrophin genes share a conserved gene structure, with almost identical sizes of the 8 RFP-TM domain-encoding exons and highly conserved exon-intron boundaries. Each of the 4 bestrophin genes has a unique 3-prime end of variable length (Stohr et al., 2002 [PubMed 12032738]; Tsunenari et al., 2003 [PubMed 12907679]).[supplied by OMIM, Mar 2008] Transcript Variant: This variant (6) lacks a portion of the 5' UTR and 5' coding region, uses a downstream in-frame start codon, and lacks several 3' exons but includes an alternate 3' terminal exon, compared to variant 1. The encoded isoform (5) is shorter at the N-terminus, has a distinct C-terminus and is significantly shorter than isoform 1. Both variants 5 and 6 encode isoform 5. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它Bestrophin 3产品
Customer
Reviews
Loading...