Protamine 2 (PRM2) (NM_001286357) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	CT94.2
Vector	pCMV6-Entry
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >SC333381 representing NM_001286357. Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTCCGATACCGCGTGAGGAGCCTGAGCGAACGCTCGCACGAGGTGTACAGGCAGCAGTTGCATGGG CAAGAGCAAGGACACCACGGCCAAGAGGAGCAAGGGCTGAGCCCGGAGCACGTCGAGGTCTACGAGAGG ACCCATGGCCAGTCTCACTATAGGCGCAGACACTGCTCTCGAAGGAGGCTGCACCGGATCCACAGGCGG CAGCATCGCTCCTGCAGAAGGCACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites	SgfI-MluI
ACCN	NM_001286357
Insert Size	234 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001286357.1
RefSeq Size	608 bp
RefSeq ORF	234 bp
Locus ID	5620
MW	9.7 kDa
Gene Summary	Protamines substitute for histones in the chromatin of sperm during the haploid phase of spermatogenesis, and are the major DNA-binding proteins in the nucleus of sperm in many vertebrates. They package the sperm DNA into a highly condensed complex in a volume less than 5% of a somatic cell nucleus. Many mammalian species have only one protamine (protamine 1); however, a few species, including human and mouse, have two. This gene encodes protamine 2, which is cleaved to give rise to a family of protamine 2 peptides. Alternatively spliced transcript variants have also been found for this gene. [provided by RefSeq, Sep 2015] Transcript Variant: This variant (3) uses alternate donor and acceptor splice sites at the junction of exons 1 and 2 compared to variant 1. The resulting isoform (3) lacks an internal protein segment and has a shorter C-terminus compared to isoform 1.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.