HOXD8 (NM_001199747) Human Untagged Clone
CAT#: SC333545
HOXD8 (untagged) - Human homeobox D8 (HOXD8), transcript variant 3
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
HOXD8 mouse monoclonal antibody,clone OTI2A1
CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HOX4; HOX4E; HOX5.4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC333545 representing NM_001199747.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTTTCCGTGGATGAGACCACAAGCAGCTCCTGGTAGACGAAGAGGAAGACAAACCTACAGTCGCTTC CAAACTCTAGAGTTGGAAAAGGAATTTCTTTTTAACCCCTATCTGACCAGGAAAAGAAGAATCGAGGTT TCCCACGCCCTAGCCCTCACCGAGAGACAGGTAAAAATCTGGTTCCAGAACAGGAGAATGAAATGGAAA AAGGAAAACAACAAGGACAAATTTCCCGTTTCCCGGCAGGAGGTGAAGGACGGGGAAACGAAAAAGGAA GCCCAAGAGCTGGAGGAAGACAGAGCCGAAGGCCTGACAAATTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001199747 |
Insert Size | 321 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001199747.1 |
RefSeq Size | 1624 bp |
RefSeq ORF | 321 bp |
Locus ID | 3234 |
Protein Families | ES Cell Differentiation/IPS, Transcription Factors |
MW | 12.9 kDa |
Gene Summary | This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. In addition to effects during embryogenesis, this particular gene may also play a role in adult urogenital tract function. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Dec 2010] Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...