RPL36A (NM_001199972) Human Untagged Clone

CAT#: SC333549

RPL36A (untagged) - Human ribosomal protein L36a (RPL36A), transcript variant 2



  "NM_001199972" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-RPL36A Antibody
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms L36A; L44L; MIG6; RPL44
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333549 representing NM_001199972.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATTGCTCCTACCGACTCCCATGAGGAAGTGCGATCGGGAACCTCCTATATACTTCCGTTTGCCTCG
CGGTTTCTTTCTTTCCGCGCCGATAGCGCTCACGCAAGCATGGTTAACGTCCCTAAAACCCGCCGGACT
TTCTGTAAGAAGTGTGGCAAGCACCAACCCCATAAAGTGACACAGTACAAGAAGGGCAAGGATTCTCTG
TACGCCCAGGGAAAGCGGCGTTATGACAGGAAGCAGAGTGGCTATGGTGGGCAAACTAAGCCGATTTTC
CGGAAAAAGGTGAGTGGTAGTTACTATTTGACGTTTCCCAGTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001199972
Insert Size 321 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001199972.1
RefSeq Size 2361 bp
RefSeq ORF 321 bp
Locus ID 6173
Protein Pathways Ribosome
MW 12.1 kDa
Gene Summary Cytoplasmic ribosomes, organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein, which shares sequence similarity with yeast ribosomal protein L44, belongs to the L44E (L36AE) family of ribosomal proteins. Although this gene has been referred to as ribosomal protein L44 (RPL44), its official name is ribosomal protein L36a (RPL36A). This gene and the human gene officially named ribosomal protein L36a-like (RPL36AL) encode nearly identical proteins; however, they are distinct genes. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Naturally occurring read-through transcription occurs between this locus and the heterogeneous nuclear ribonucleoprotein H2 (H') gene. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (2) differs in the 3' coding region and 3' UTR, compared to variant 1. The resulting isoform (b) has a distinct C-terminus and is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...