GTF2IRD2 (NM_001281447) Human Untagged Clone

CAT#: SC333568

GTF2IRD2 (untagged) - Human GTF2I repeat domain containing 2 (GTF2IRD2), transcript variant 2



  "NM_001281447" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-GTF2IRD2 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FP630; GTF2IRD2 alpha; GTF2IRD2A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333568 representing NM_001281447.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCCAGGTAGCAGTGTCCACCCTGCCTGTTGAAGAAGAGTCCTCCTCAGAGACCAGGATGGTGGTG
ACATTCCTCGTGTCTGCCCTCGAATCCATGTGTAAAGAACTGGCCAAGTCCAAGGCAGAAGTGGCCTGC
ATCGCAGTGTACGAAACAGACGTGTTTGTCGTCGGAACCGAGAGAGGATGCGCTTTTGTTAATGCCAGG
ACGGATTTTCAGAAAGATTTTGCAAAATACTGTAGGTGTTTTAATTTTATCCTTTGTATTCCCAATCTC
AAAAGGATCGCAGGCAAGACTTCCACAGTATTTTCTTCTAAGCTATCATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001281447
Insert Size 327 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001281447.1
RefSeq Size 648 bp
RefSeq ORF 327 bp
Locus ID 84163
UniProt ID Q86UP8
Protein Families Transcription Factors
MW 11.9 kDa
Gene Summary This gene is one of several closely related genes on chromosome 7 encoding proteins containing helix-loop-helix motifs. These proteins may function as regulators of transcription. The encoded protein is unique in that its C-terminus is derived from CHARLIE8 transposable element sequence. This gene is located in a region of chromosome 7 that is deleted in Williams-Beuren syndrome, and loss of this locus may contribute to the cognitive phenotypes observed in this disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (2) lacks multiple 3' coding exons and its transcription extends past a splice site used in the variant 1, resulting in a distinct 3' coding region and 3' UTR. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...