Fucose mutarotase (FUOM) (NM_001301828) Human Untagged Clone

CAT#: SC333569

FUOM (untagged) - Human fucose mutarotase (FUOM), transcript variant 4



  "NM_001301828" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


FUOM rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C10orf125; FucM; FUCU
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333569 representing NM_001301828.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGATCCGTGCAGACGGCCTGGGCATCCCGCAGCTCCTGGAGGCCGTGCTGAAGCTGCTGCCCCTG
GACACCTATGTGGAGAGTCCGGCTGCAGTCATGGAGCTGGTGCCCAGCGACAAGGAGAGGGGCCTGCAG
ACCCCAGTGTGGACGGAGTACGAGTCCATCCTACGCAGGGCCGGCTGTGTGAGAGCCCTGGCAAAGATA
GAGAGGTTTGAGTTTTATGAACGGGCTAAGAAGGCTTTTGCTGTTGTGGCAACGGGGGAGACGGCCCTC
TACGGAAACCTCATCCTCAGGAAGGGGGTGCTTGCCCTCAACCCCCTGCTGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001301828
Insert Size 330 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001301828.1
RefSeq Size 906 bp
RefSeq ORF 330 bp
Locus ID 282969
UniProt ID A2VDF0
MW 12.1 kDa
Gene Summary Involved in the interconversion between alpha- and beta-L-fucoses. L-Fucose (6-deoxy-L-galactose) exists as alpha-L-fucose (29.5%) and beta-L-fucose (70.5%), the beta-form is metabolized through the salvage pathway. GDP-L-fucose formed either by the de novo or salvage pathways is transported into the endoplasmic reticulum, where it serves as a substrate for N- and O-glycosylations by fucosyltransferases. Fucosylated structures expressed on cell surfaces or secreted in biological fluids are believed to play a critical role in cell-cell adhesion and recognition processes.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) uses an alternate splice site in the 5' region, and it thus differs in its 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (4) is shorter at the N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...