NDUFA5 (NM_001282421) Human Untagged Clone

CAT#: SC333592

NDUFA5 (untagged) - Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5 (NDUFA5), transcript variant 4



  "NM_001282421" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
NDUFA5 mouse monoclonal antibody, clone OTI1E8 (formerly 1E8)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms B13; CI-13kB; CI-13KD-B; NUFM; UQOR13
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333592 representing NM_001282421.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCTTACCGGACCACTGGCCTTGTGGGATTGGCTGTGTGCAATACTCCTCACGAGAGGCTAAGAATA
TTGTACACAAAGATTCTTGATGTTCTTGAGGAAATCCCTAAAAATGCAGCATATAGAAAGTATACAGAA
CAGATTACAAATGAGAAGCTGGCTATGGTTAAAGCGGAACCAGATGTTAAAAAATTAGAAGACCAACTT
CAAGGCGGTCAATTAGAAGAGGTGATTCTTCAGGCTGAACATGAACTAAATCTGGCAAGAAAAATGAGG
GAATGGAAACTATGGGAGCCATTAGTGGAAGAGCCTCCTGCCGATCAGTGGAAATGGCCAATATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001282421
Insert Size 342 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282421.2
RefSeq Size 5610 bp
RefSeq ORF 342 bp
Locus ID 4698
UniProt ID Q16718
Protein Pathways Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
MW 13.3 kDa
Gene Summary This nuclear gene encodes a conserved protein that comprises the B13 subunit of complex I of the mitochondrial respiratory chain. The encoded protein localizes to the inner mitochondrial membrane, where it is thought to aid in the transfer of electrons from NADH to ubiquinone. Alternative splicing results in multiple transcript variants. There are numerous pseudogenes of this gene on chromosomes 1, 3, 6, 8, 9, 11, 12, and 16. [provided by RefSeq, Apr 2014]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (4) is shorter than isoform 1 and has a distinct N-terminus. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...