Apc10 (ANAPC10) (NM_001256711) Human Untagged Clone
CAT#: SC333601
ANAPC10 (untagged) - Human anaphase promoting complex subunit 10 (ANAPC10), transcript variant 7
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | APC10; DOC1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC333601 representing NM_001256711.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGACTACACCAAACAAGACACCTCCTGGTGCTGACCCCAAGCAGTTGGAAAGGACTGGAACAGTACGG GAAATTGGGTCACAAGCTGTTTGGTCACTCTCATCTTGCAAACCAGGATTTGGAGTGGATCAGTTACGA GATGACAATCTAGAAACTTATTGGCAATCAGATGGTTCCCAGCCTCATTTAGTGAACATCCAATTCAGA AGAAAAACAACAGTGAAGACATTATGTATTTATGCAGACTACAAATCTGATGAAAGCTATACTCCAAGC AAGATCTCAGTCAGAGTAGGAAATAATTTTCACAACCTTCAAGAAATTCGGGCTTTGGTATCAGGATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001256711 |
Insert Size | 345 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001256711.1 |
RefSeq Size | 1579 bp |
RefSeq ORF | 345 bp |
Locus ID | 10393 |
Protein Families | Druggable Genome |
Protein Pathways | Cell cycle, Oocyte meiosis, Progesterone-mediated oocyte maturation, Ubiquitin mediated proteolysis |
MW | 12.8 kDa |
Gene Summary | ANAPC10 is a core subunit of the anaphase-promoting complex (APC), or cyclosome, a ubiquitin protein ligase that is essential for progression through the cell cycle. APC initiates sister chromatid separation by ubiquitinating the anaphase inhibitor securin (PTTG1; MIM 604147) and triggers exit from mitosis by ubiquitinating cyclin B (CCNB1; MIM 123836), the activating subunit of cyclin-dependent kinase-1 (CDK1; MIM 116940) (summary by Wendt et al., 2001 [PubMed 11524682]).[supplied by OMIM, Feb 2011] Transcript Variant: This variant (7) differs in the 5' UTR and includes an alternate exon in the 3' coding region, which results in a frameshift, compared to variant 1. Variants 6 and 7 encode the same isoform (3), which is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...