SDHC (NM_001278172) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	CYB560; CYBL; PGL3; QPS1; SDH3
Vector	pCMV6-Entry
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >SC333623 representing NM_001278172. Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTGCGCTGTTGCTGAGACACGTTGGTCGTCATTGCCTCCGAGCCCACTTTAGCCCTCAGCTCTGT ATCAGAAATTGGTCTCTTCCCATGGCGATGTCCATCTGCCACCGTGGCACTGGTATTGCTTTGAGTGCA GATGTGGGACCTAGGAAAAGGCCTGAAGATTCCCCAGCTATACCAGTCTGGAGTGGTTGTCCTGGTTCT TACTGTGTTGTCCTCTATGGGGCTGGCAGCCATGTGAAGAAAGGAGGCTCCCAGCATCATCTTCCTACA CATTATTACATTCACCCATCTTTCTGTTTGTCATTCTTATCTCCAGCCTGGGAAAAGTTCTCCTTATTT GTTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites	SgfI-MluI
ACCN	NM_001278172
Insert Size	351 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001278172.1
RefSeq Size	2592 bp
RefSeq ORF	351 bp
Locus ID	6391
UniProt ID	Q99643
Protein Families	Druggable Genome, Transmembrane
Protein Pathways	Alzheimer's disease, Citrate cycle (TCA cycle), Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
MW	12.8 kDa
Gene Summary	This gene encodes one of four nuclear-encoded subunits that comprise succinate dehydrogenase, also known as mitochondrial complex II, a key enzyme complex of the tricarboxylic acid cycle and aerobic respiratory chains of mitochondria. The encoded protein is one of two integral membrane proteins that anchor other subunits of the complex, which form the catalytic core, to the inner mitochondrial membrane. There are several related pseudogenes for this gene on different chromosomes. Mutations in this gene have been associated with paragangliomas. Alternatively spliced transcript variants have been described. [provided by RefSeq, May 2013] Transcript Variant: This variant (5, also known as delta 3+5), lacks two alternate exons, which results in a frameshift, compared to variant 1. The encoded isoform (5) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.