NME4 (NM_001286436) Human Untagged Clone

CAT#: SC333627

NME4 (untagged) - Human NME/NM23 nucleoside diphosphate kinase 4 (NME4), transcript variant 4



  "NM_001286436" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Anti-NME4 mouse monoclonal antibody, clone OTI1A5 (formerly 1A5)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NDPK-D; nm23-H4; NM23H4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333627 representing NM_001286436.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGATGCTGCAGGCACCAGAGAGCGTCCTTGCCGAGCACTACCAGGACCTGCGGAGGAAGCCCTTC
TACCCTGCCCTCATCCGCTACATGAGCTCTGGGCCTGTGGTGGCCATGGTCTGGGAAGGGTACAATGTC
GTCCGCGCCTCGAGGGCCATGATTGGACACACCGACTCGGCTGAGGCTGCCCCAGGAACCATAAGGGGT
GACTTCAGCGTCCACATCAGCAGGAATGTCATCCACGCCAGCGACTCCGTGGAGGGGGCCCAGCGGGAG
ATCCAGCTGTGGTTCCAGAGCAGTGAGCTGGTGAGCTGGGCAGACGGGGGCCAGCACAGCAGCATCCAC
CCAGCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001286436
Insert Size 354 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001286436.1
RefSeq Size 1262 bp
RefSeq ORF 354 bp
Locus ID 4833
UniProt ID O00746
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Purine metabolism, Pyrimidine metabolism
MW 13 kDa
Gene Summary The nucleoside diphosphate (NDP) kinases (EC 2.7.4.6) are ubiquitous enzymes that catalyze transfer of gamma-phosphates, via a phosphohistidine intermediate, between nucleoside and dioxynucleoside tri- and diphosphates. The enzymes are products of the nm23 gene family, which includes NME4 (Milon et al., 1997 [PubMed 9099850]).[supplied by OMIM, May 2008]
Transcript Variant: This variant (4) contains an alternate exon in the 5' UTR and initiates translation at an alternate downstream start codon compared to variant 1. The resulting isoform (d) is shorter at the N-terminus compared to isoform a. Variants 4, 5, 6, and 7 all encode the same isoform (d).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...