IFI27 (NM_001288956) Human Untagged Clone
CAT#: SC333686
IFI27 (untagged) - Human interferon, alpha-inducible protein 27 (IFI27), transcript variant 5
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FAM14D; ISG12; ISG12A; P27 |
Vector | pCMV6-Entry |
Sequence Data |
>SC333686 representing NM_001288956.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGAGGCCTCTGCTCTCACCTCATCAGCAGTGACCAGTGTGGCCAAAGTGGTCAGGGTGGCCTCTGGC TCTGCCGTAGTTTTGCCCCTGGCCAGGATTGCTACAGTTGTGATTGGAGGAGTTGTGGCCATGGCGGCT GTGCCCATGGTGCTCAGTGCCATGGGCTTCACTGCGGCGGGAATCGCCTCGTCCTCCATAGCAGCCAAG ATGATGTCCGCGGCGGCCATTGCCAATGGGGGTGGAGTTGCCTCGGGCAGCCTTGTGGCTACTCTGCAG TCACTGGGAGCAACTGGACTCTCCGGATTGACCAAGTTCATCCTGGGCTCCATTGGGTCTGCCATTGCG GCTGTCATTGCGAGGTTCTACTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001288956 |
Insert Size | 369 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001288956.1 |
RefSeq Size | 647 bp |
RefSeq ORF | 369 bp |
Locus ID | 3429 |
UniProt ID | P40305 |
Protein Families | Transmembrane |
MW | 11.5 kDa |
Gene Summary | Probable adapter protein involved in different biological processes (PubMed:22427340, PubMed:27194766). Part of the signaling pathways that lead to apoptosis (PubMed:18330707, PubMed:27673746, PubMed:24970806). Involved in type-I interferon-induced apoptosis characterized by a rapid and robust release of cytochrome C from the mitochondria and activation of BAX and caspases 2, 3, 6, 8 and 9 (PubMed:18330707, PubMed:27673746). Also functions in TNFSF10-induced apoptosis (PubMed:24970806). May also have a function in the nucleus, where it may be involved in the interferon-induced negative regulation of the transcriptional activity of NR4A1, NR4A2 and NR4A3 through the enhancement of XPO1-mediated nuclear export of these nuclear receptors (PubMed:22427340). May thereby play a role in the vascular response to injury (By similarity). In the innate immune response, has an antiviral activity towards hepatitis C virus/HCV (PubMed:27194766, PubMed:27777077). May prevent the replication of the virus by recruiting both the hepatitis C virus non-structural protein 5A/NS5A and the ubiquitination machinery via SKP2, promoting the ubiquitin-mediated proteasomal degradation of NS5A (PubMed:27194766, PubMed:27777077).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (5) lacks an internal segment in the 5' UTR, compared to variant 1. This variant corresponds to the allele present in the GRC reference assembly. Variants 1, 3 and 5, 11 and 12 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...