PGAP2 (NM_001283040) Human Untagged Clone

CAT#: SC333696

PGAP2 (untagged) - Human post-GPI attachment to proteins 2 (PGAP2), transcript variant 19



  "NM_001283040" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CWH43-N; FRAG1; HPMRS3; MRT17; MRT21
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333696 representing NM_001283040.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTAGATTGGGAAGCACCGGCGGGGTGTCGGGAAGGGTGGTGACGCAACATAGAGACTCCGCCCCC
TTCCTTGGAGCGCCGCGACTCGGGCTGAGGGAGCTCGGGCCAATCAGAGGGACGGCCCCAGAATGGCAT
GGTAGATGGAACGCAGCTGAGAGCCATCCACGAAAATGCTTTCATTGTGTTCATTGCCTCATCCCTCGG
GCACATGCTCCTCACCTGCATTCTCTGGCGGTTGACCAAGAAGCACACAGTAAGTCAGGAGGATCGCAA
GTCCTACAGCTGGAAACAGCGGCTCTTCATCATCAACTTCATCTCCTTCTTCTCGGCGCTGGCTGTCTA
CTTTCGGCACAACATGTATTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001283040
Insert Size 369 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001283040.1
RefSeq Size 1460 bp
RefSeq ORF 369 bp
Locus ID 27315
UniProt ID Q9UHJ9
Protein Families Druggable Genome, Transmembrane
MW 13.1 kDa
Gene Summary The protein encoded by this gene plays a role in the maturation of glycosylphosphatidylinositol (GPI) anchors on GPI-anchored proteins. Mutations in this gene are associated with an autosomal recessive syndrome characterized by hyperphosphatasia and intellectual disability. [provided by RefSeq, Jul 2017]
Transcript Variant: This variant (19) uses an alternate exon structure in the 5' region compared to variant 1. The encoded isoform (11) is distinct and shorter, compared to isoform 1, but it shares regions in common with isoforms 5 and 7.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...