ARL 1 (ARL1) (NM_001301068) Human Untagged Clone

CAT#: SC333833

ARL1 (untagged) - Human ADP-ribosylation factor-like 1 (ARL1), transcript variant 2



  "NM_001301068" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
ARL1 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARFL1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333833 representing NM_001301068.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCATTGGATTTAATGTAGAGACGGTGACGTACAAAAACCTTAAATTCCAAGTCTGGGATTTAGGA
GGACAGACAAGTATCAGGCCATACTGGAGATGTTACTATTCAAACACAGATGCAGTCATTTATGTAGTA
GACAGTTGTGACCGAGACCGAATTGGCATTTCCAAATCAGAGTTAGTTGCCATGTTGGAGGAAGAAGAG
CTGAGAAAAGCCATTTTAGTGGTGTTTGCAAATAAACAGGACATGGAACAGGCCATGACTTCCTCAGAG
ATGGCAAATTCACTTGGGTTACCTGCCTTGAAGGACCGAAAATGGCAGATATTCAAAACGTCAGCAACC
AAAGGCACCGGCCTTGATGAGGCAATGGAATGGTTAGTTGAAACATTAAAAAGCAGACAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001301068
Insert Size 408 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001301068.1
RefSeq Size 3115 bp
RefSeq ORF 408 bp
Locus ID 400
MW 15.4 kDa
Gene Summary The protein encoded by this gene belongs to the ARL (ADP-ribosylation factor-like) family of proteins, which are structurally related to ADP-ribosylation factors (ARFs). ARFs, described as activators of cholera toxin (CT) ADP-ribosyltransferase activity, regulate intracellular vesicular membrane trafficking, and stimulate a phospholipase D (PLD) isoform. Although, ARL proteins were initially thought not to activate CT or PLD, later work showed that they are weak stimulators of PLD and CT in a phospholipid dependent manner. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...