PGRMC1 (NM_001282621) Human Untagged Clone

CAT#: SC333901

PGRMC1 (untagged) - Human progesterone receptor membrane component 1 (PGRMC1), transcript variant 2



  "NM_001282621" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


PGRMC1 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Dap1; HPR6.6; IZA; MPR
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333901 representing NM_001282621.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTGCCGAGGATGTGGTGGCGACTGGCGCCGACCCAAGCGATCTGGAGAGCGGCGGGCTGCTGCAT
GAGATTTTCACGTCGCCGCTCAACCTGCTGCTGCTTGGCCTCTGCATCTTCCTGCTCTACAAGATCGTG
CGCGGGGACCAGCCGGCGGCCAGCGGCGACAGCGACGACGACGAGCCGCCCCCTCTGCCCCGCCTCAAG
CGGCGCGACTTCACCCCCGCCGAGCTGCGGCGCTTCGACGGCGTCCAGGACCCGCGCATACTCATGGCC
ATCAACGGCAAGGTGTTCGATGTGACCAAAGGCCGCAAATTCTACGGGCCCGTCAAGTATCATCACGTG
GGCAAACTGCTGAAGGAGGGGGAGGAGCCCACTGTGTACTCAGATGAGGAAGAACCAAAAGATGAGAGT
GCCCGGAAAAATGATTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001282621
Insert Size 432 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282621.1
RefSeq Size 1772 bp
RefSeq ORF 432 bp
Locus ID 10857
UniProt ID O00264
Protein Families Druggable Genome, Nuclear Hormone Receptor, Transmembrane
MW 15.9 kDa
Gene Summary This gene encodes a putative membrane-associated progesterone steroid receptor. The protein is expressed predominantly in the liver and kidney. [provided by RefSeq, Mar 2010]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region compared to variant 1. It encodes isoform 2 which is shorter compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...