TAL1 (NM_001290406) Human Untagged Clone

CAT#: SC334150

TAL1 (untagged) - Human T-cell acute lymphocytic leukemia 1 (TAL1), transcript variant 6



  "NM_001290406" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TAL1 mouse monoclonal antibody, clone OTI5H1 (formerly 5H1)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms bHLHa17; SCL; tal-1; TCL5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001290406, the custom clone sequence may differ by one or more nucleotides


ATGTTCACCACCAACAATCGAGTGAAGAGGAGACCTTCCCCCTATGAGATGGAGATTACTGATGGTCCCC
ACACCAAAGTTGTGCGGCGTATCTTCACCAACAGCCGGGAGCGATGGCGGCAGCAGAATGTGAACGGGGC
CTTTGCCGAGCTCCGCAAGCTGATCCCCACACATCCCCCGGACAAGAAGCTCAGCAAGAATGAGATCCTC
CGCCTGGCCATGAAGTATATCAACTTCTTGGCCAAGCTGCTCAATGACCAGGAGGAGGAGGGCACCCAGC
GGGCCAAGACTGGCAAGGACCCTGTGGTGGGGGCTGGTGGGGGTGGAGGTGGGGGAGGGGGCGGCGCGCC
CCCAGATGACCTCCTGCAAGACGTGCTTTCCCCCAACTCCAGCTGCGGCAGCTCCCTGGATGGGGCAGCC
AGCCCGGACAGCTACACGGAGGAGCCCGCGCCCAAGCACACGGCCCGCAGCCTCCATCCTGCCATGCTGC
CTGCCGCCGATGGAGCCGGCCCTCGGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001290406
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001290406.1, NP_001277335.1
RefSeq Size 4171 bp
RefSeq ORF 519 bp
Locus ID 6886
UniProt ID P17542
Protein Families Adult stem cells, Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors
Gene Summary Implicated in the genesis of hemopoietic malignancies. It may play an important role in hemopoietic differentiation. Serves as a positive regulator of erythroid differentiation (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (6) lacks three consecutive internal exons in the 5' region and uses a downstream translation start codon, compared to variant 1. The resulting isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...