BOULE (BOLL) (NM_001284358) Human Untagged Clone

CAT#: SC334178

BOLL (untagged) - Human boule-like RNA-binding protein (BOLL), transcript variant 3



  "NM_001284358" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Purified BOLL mouse monoclonal antibody, clone OTI2D11 (formerly 2D11)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BOULE
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001284358, the custom clone sequence may differ by one or more nucleotides


ATGACAGAGCTGGAGTATCCAAAGGGTTCTAGTATAATGCCAGCAGCTGGAACAATGTATCTAACAACTT
CAACTGGATATCCTTATACTTACCATAATGGTGTTGCTTATTTTCATACTCCAGAGGTAACTTCGGTCCC
ACCGCCTTGGCCTTCACGTTCTGTATGTAGCTCCCCTGTGATGGTAGCTCAGCCCATTTATCAGCAACCT
GCATATCACTACCAGGCCACCACACAGTATTTACCAGGACAGTGGCAGTGGAGTGTTCCTCAGCCTTCTG
CCTCTTCTGCTCCATTCTTATACCTGCAACCTTCTGAGGTTATTTATCAACCAGTGGAAATTGCACAGGA
TGGTGGATGTGTTCCTCCTCCACTGTCTCTGATGGAAACTTCAGTTCCAGAGCCTTATTCTGATCATGGA
GTTCAAGCAACATATCACCAGGTTTATGCTCCAAGTGCCATCACTATGCCTGCGCCTGTGATGCAGCCTG
AGCCAATTAAAACAGTGTGGAGCATTCATTATTAA


Restriction Sites SgfI-MluI     
ACCN NM_001284358
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001284358.1, NP_001271287.1
RefSeq Size 2742 bp
RefSeq ORF 525 bp
Locus ID 66037
UniProt ID Q8N9W6
Gene Summary This gene belongs to the DAZ gene family required for germ cell development. It encodes an RNA-binding protein which is more similar to Drosophila Boule than to human proteins encoded by genes DAZ (deleted in azoospermia) or DAZL (deleted in azoospermia-like). Loss of this gene function results in the absence of sperm in semen (azoospermia). Histological studies demonstrated that the primary defect is at the meiotic G2/M transition. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) differs in the 5' UTR and lacks two consecutive exons in the 5' coding region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (3) is shorter and has a distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...