CNOT8 (NM_001301083) Human Untagged Clone

CAT#: SC334283

CNOT8 (untagged) - Human CCR4-NOT transcription complex, subunit 8 (CNOT8), transcript variant 8



  "NM_001301083" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit polyclonal CNOT8 Antibody (C-term)
    • 400 ul

CNY 6314.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CAF1; Caf1b; CALIF; hCAF1; POP2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001301083, the custom clone sequence may differ by one or more nucleotides


ATGTACTCCCAGGATTCCATAGATCTCCTTGCTAACTCAGGACTACAGTTTCAGAAGCATGAAGAGGAAG
GGATTGACACACTGCACTTTGCAGAGCTGCTTATGACATCAGGAGTGGTTCTCTGTGACAATGTCAAATG
GCTTTCATTTCATAGTGGCTATGATTTTGGCTATATGGTAAAGTTGCTTACAGATTCTCGTTTGCCAGAA
GAGGAACATGAATTCTTTCATATTCTGAACCTTTTCTTCCCATCCATTTATGATGTGAAATACCTGATGA
AGAGCTGCAAAAATCTTAAGGGAGGTCTTCAGGAAGTTGCTGATCAGTTGGATTTGCAGAGGATTGGAAG
GCAGCACCAGGCAGGCTCAGACTCACTGCTGACAGGAATGGCTTTCTTTAGGATGAAAGAGTTGTTTTTT
GAGGACAGCATTGATGATGCCAAGTACTGTGGGCGGCTCTATGGCTTAGGCACAGGAGTGGCCCAGAAGC
AGAATGAGGATGTGGACTCTGCCCAGGAGAAGATGAGCATCCTGGCGATTATCAACAACATGCAGCAGTG
A


Restriction Sites SgfI-MluI     
ACCN NM_001301083
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001301083.1, NP_001288012.1
RefSeq Size 2265 bp
RefSeq ORF 561 bp
Locus ID 9337
UniProt ID Q9UFF9
Protein Families Transcription Factors
Protein Pathways RNA degradation
Gene Summary Has 3'-5' poly(A) exoribonuclease activity for synthetic poly(A) RNA substrate. Its function seems to be partially redundant with that of CNOT7. Catalytic component of the CCR4-NOT complex which is linked to various cellular processes including bulk mRNA degradation, miRNA-mediated repression, translational repression during translational initiation and general transcription regulation. During miRNA-mediated repression the complex seems also to act as translational repressor during translational initiation. Additional complex functions may be a consequence of its influence on mRNA expression. Associates with members of the BTG family such as TOB1 and BTG2 and is required for their anti-proliferative activity.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (8) has an alternate 5' UTR exon and also lacks two consecutive internal exons, which result in translation initiation at a downstream in-frame AUG, compared to variant 1. The resulting isoform (3) has a shorter N-terminus, compared to isoform 1. Variants 4, 5, 6, 7 and 8 encode the same isoform 3.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...