M6PR (NM_001207024) Human Untagged Clone
CAT#: SC334328
M6PR (untagged) - Human mannose-6-phosphate receptor (cation dependent) (M6PR), transcript variant 2
CNY 2,950.00
货期*
3周
规格
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
经常一起买 (4)
M6PR mouse monoclonal antibody,clone OTI2F3
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD-M6PR; CD-MPR; MPR-46; MPR 46; MPR46; SMPR |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001207024, the custom clone sequence may differ by one or more nucleotides
ATGTTCCCTTTCTACAGCTGCTGGAGGACTGGACTGCTACTACTACTCCTGGCTGTGGCAGTGAGAGAAT CCTGGCAGACAGAAGAAAAAACTTGCGACTTGGTAGGAGAAAAGGGTAAAGAGTCAGAGAAAGAGTTGGC TCTAGTGAAGAGGCTGAAACCACTGTTTAATAAAAGCTTTGAGAGCACTGTGGGCCAGGGTTCAGACACA TACATCTACATCTTCAGGGTGTGCCGGGAAGCTGGCAACCACACTTCTGGGGCAGGCCTGGTGCAAATCA ACAAAAGTAATGGGAAGGAGACAGTGGTAGGGAGACTCAACGAGACTCACATCTTCAACGGAAGTAATTG GATCATGCTGATCTATAAAGGGGGTGATGAATATGACAACCACTGTGGCAAGGAGCAGCGTCGTGCAGTG GTGATGATCTCCTGCAATCGACACACCCTAGCGGATGGCTGTGACTTTGTCTGCCGTTCTAAACCTCGAA ATGTGCCTGCAGCATATCGTGGTGTGGGGGATGACCAGCTGGGGGAGGAGTCAGAAGAAAGGGATGACCA TTTATTACCAATGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001207024 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001207024.1, NP_001193953.1 |
RefSeq Size | 2325 bp |
RefSeq ORF | 576 bp |
Locus ID | 4074 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Lysosome |
Gene Summary | This gene encodes a member of the P-type lectin family. P-type lectins play a critical role in lysosome function through the specific transport of mannose-6-phosphate-containing acid hydrolases from the Golgi complex to lysosomes. The encoded protein functions as a homodimer and requires divalent cations for ligand binding. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A pseudogene of this gene is located on the long arm of chromosome X. [provided by RefSeq, May 2011] Transcript Variant: This variant (2) lacks two consecutive exons in the 3' coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
Customer
Reviews
Loading...