Peroxiredoxin 3 (PRDX3) (NM_001302272) Human Untagged Clone

CAT#: SC334390

PRDX3 (untagged) - Human peroxiredoxin 3 (PRDX3), transcript variant 3



  "NM_001302272" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Anti-PRDX3 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AOP-1; AOP1; HBC189; MER5; PRO1748; prx-III; SP-22
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001302272, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCTGCTGTAGGACGGTTGCTCCGAGCGTCGGTTGCCCGACATGTGAGTGCCATTCCTTGGGGCA
TTTCTGCCACTGCAGCCCTCAGGCCTGCTGCATGTGGAAGAACGAGCTTGACAAATTTATTGTGTTCTGG
TTCCAGTCAAGCAAAATTATTCAGCACCAGTTCCTCATGCCATGCACCTGCTGTCACCCAGCATGCACCC
TATTTTAAGGGTACAGCCGTTGTCAATGGAGAGTTCAAAGACCTAAGCCTTGATGACTTTAAGGGGAAAT
ATTTGGTGCTTTTCTTCTATCCTTTGGATTTCACCTTTGTGTGTCCTACAGAAATTGTTGCTTTTAGTGA
CAAAGCTAACGAATTTCACGACGTGAACTGTGAAGTTGTCGCAGTCTCAGTGGATTCCCACTTTAGCCAT
CTTGCCTGGATAAATACACCAAGAAAGAATGGTGGTTTGGGCCACATGAACATCGCACTCTTGTCAGACT
TAACTAAGCAGATTTCCCGAGACTACGGTGTGCTGTTAGAAGGTTCTGGTCTTGCACTAAGATCAAGCCA
AGTCCAGCTGCTTCCAAAGAGTACTTTCAGAAGGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001302272
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001302272.1, NP_001289201.1
RefSeq Size 1475 bp
RefSeq ORF 597 bp
Locus ID 10935
UniProt ID P30048
Protein Families Transcription Factors
Gene Summary This gene encodes a mitochondrial protein with antioxidant function. The protein is similar to the C22 subunit of Salmonella typhimurium alkylhydroperoxide reductase, and it can rescue bacterial resistance to alkylhydroperoxide in E. coli that lack the C22 subunit. The human and mouse genes are highly conserved, and they map to the regions syntenic between mouse and human chromosomes. Sequence comparisons with recently cloned mammalian homologs suggest that these genes consist of a family that is responsible for the regulation of cellular proliferation, differentiation and antioxidant functions. This family member can protect cells from oxidative stress, and it can promote cell survival in prostate cancer. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 1, 3, 13 and 22. [provided by RefSeq, Oct 2014]
Transcript Variant: This variant (3) lacks an alternate exon that results in a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (c) has a distinct C-terminus and is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...