RAB30 (NM_001286061) Human Untagged Clone
CAT#: SC334427
RAB30 (untagged) - Human RAB30, member RAS oncogene family (RAB30), transcript variant 4
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
RAB30 mouse monoclonal antibody, clone OTI3E7 (formerly 3E7)
CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001286061, the custom clone sequence may differ by one or more nucleotides
ATGAGTATGGAAGATTATGATTTCCTGTTCAAAATTGTTTTAATTGGCAACGCTGGTGTGGGGAAGACGT GCCTCGTCCGAAGATTCACTCAGGGTCTTTTCCCCCCAGGTCAAGGAGCCACAATTGGAGTTGATTTTAT GATTAAGACAGTGGAGATTAATGGTGAAAAAGTAAAGCTACAGATCTGGGACACAGCAGGTCAAGAGAGA TTTCGGTCCATTACCCAGAGTTACTACCGAAGCGCCAATGCCTTGATCCTCACCTATGACATTACCTGTG AGGAATCCTTCCGTTGCCTTCCTGAGTGGCTGCGGGAGATAGAACAATATGCCAGCAACAAGGTCATCAC TGTGTTAGTGGGCAACAAGATTGACCTGGCTGAAAGGAGAGAGGTTTCCCAGCAGCGAGCTGAAGAATTC TCAGAAGCTCAGGACATGTATTATCTGGAGACCTCAGCCAAGGAATCTGATAATGTGGAGAAACTCTTCC TTGACTTAGCATGCCGACTCATCAGTGAAGCCAGACAGAACACACTTGTGAACAATGTATCCTCACCCTT ACCTGGAGAAGGGAAAAGCATCAGCTATTTGACTTGTTGTAATTTCAACTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001286061 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001286061.1, NP_001272990.1 |
RefSeq Size | 9783 bp |
RefSeq ORF | 612 bp |
Locus ID | 27314 |
UniProt ID | Q15771 |
Protein Families | Druggable Genome |
Gene Summary | The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different set of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion (By similarity). Required for maintaining the structural integrity of the Golgi apparatus, possibly by mediating interactions with cytoplasmic scaffolding proteins.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (4) differs in the 5' UTR, compared to variant 1. Variants 1, 2, 3, and 4 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...