E2F6 (NM_001278277) Human Untagged Clone

CAT#: SC334454

E2F6 (untagged) - Human E2F transcription factor 6 (E2F6), transcript variant d



  "NM_001278277" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-E2F6 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms E2F-6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278277, the custom clone sequence may differ by one or more nucleotides


ATGGATCTTGTCAGATCTGCTCCCGGGGGTATTCTTGACTTAAACAAGGTTGCAACGAAACTGGGAGTCC
GAAAGCGGAGAGTGTATGACATCACCAATGTCTTAGATGGAATCGACCTCGTTGAAAAGAAATCCAAGAA
CCATATTAGATGGATAGGATCTGATCTTAGCAATTTTGGAGCAGTTCCCCAACAAAAGAAGCTACAGGAG
GAACTTTCTGACTTATCAGCAATGGAAGATGCTTTGGATGAGTTAATTAAGGATTGTGCTCAGCAGCTGT
TTGAGTTAACAGATGACAAAGAAAATGAAAGACTAGCATATGTGACCTATCAAGACATTCATAGCATTCA
GGCCTTCCATGAACAGATCGTCATTGCAGTTAAAGCTCCAGCAGAAACCAGATTGGATGTTCCAGCTCCC
AGAGAAGACTCTATCACAGTGCACATAAGGAGCACCAACGGACCTATCGATGTCTATTTGTGTGAAGTGG
AGCAGGGTCAGACCAGTAACAAAAGGTCTGAAGGTGTCGGGACCTCTTCATCTGAGAGCACTCATCCAGA
AGGCCCTGAGGAAGAAGAAAATCCTCAGCAAAGTGAAGAATTGCTTGAAGTAAGCAACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001278277
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278277.1, NP_001265206.1
RefSeq Size 3450 bp
RefSeq ORF 621 bp
Locus ID 1876
UniProt ID O75461
Protein Families Transcription Factors
Gene Summary This gene encodes a member of a family of transcription factors that play a crucial role in the control of the cell cycle. The protein encoded by this gene lacks the transactivation and tumor suppressor protein association domains found in other family members, and contains a modular suppression domain that functions in the inhibition of transcription. It interacts in a complex with chromatin modifying factors. There are pseudogenes for this gene on chromosomes 22 and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Transcript Variant: This variant (d) contains two alternate exons and initiates translation at a downstream in-frame start codon, compared to variant a. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1. Variants c, d, and e encode the same isoform (3). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...