CEACAM3 (NM_001277163) Human Untagged Clone
CAT#: SC334500
CEACAM3 (untagged) - Human carcinoembryonic antigen-related cell adhesion molecule 3 (CEACAM3), transcript variant 2
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD66D; CEA; CGM1; W264; W282 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001277163, the custom clone sequence may differ by one or more nucleotides
ATGGGGCCCCCCTCAGCCTCTCCCCACAGAGAATGCATCCCCTGGCAGGGGCTTCTGCTCACAGCCTCAC TTCTAAACTTCTGGAACCCGCCCACCACTGCCAAGCTCACTATTGAATCCATGCCGCTCAGTGTCGCAGA GGGGAAGGAGGTGCTTCTACTTGTCCACAATCTGCCCCAGCATCTTTTTGGCTACAGCTGGTACAAAGGG GAAAGAGTGGATGGCAACAGTCTAATTGTAGGATATGTAATAGGAACTCAACAAGCTACCCCAGGGGCCG CATACAGCGGTCGAGAGACAATATACACCAATGCATCCCTGCTGATCCAGAATGTCACCCAGAATGACAT AGGATTCTACACCCTACAAGTCATAAAGTCAGATCTTGTGAATGAAGAAGCAACTGGACAGTTCCATGTA TACCAAGAAAATGCCCCAGGCCTTCCTGTGGGGGCCGTCGCCGGCATCGTGACCGGGGTCCTGGTCGGAG TGGCGCTGGTGGCCGCGCTGGTGTGTTTCCTGCTCCTTGCCAAAACTGGAAGGCCGTGGTCCCTCCCACA GCTCTGCCTTCTCGATGTCCCCTCTCTCCACTGCCCAGGCCCCCCTACCCAACCCCAGGACAGCAGCTTC CATCTATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001277163 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001277163.2, NP_001264092.1 |
RefSeq Size | 1058 bp |
RefSeq ORF | 639 bp |
Locus ID | 1084 |
UniProt ID | P40198 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a member of the family of carcinoembryonic antigen-related cell adhesion molecules (CEACAMs), which are used by several bacterial pathogens to bind and invade host cells. The encoded transmembrane protein directs phagocytosis of several bacterial species that is dependent on the small GTPase Rac. It is thought to serve an important role in controlling human-specific pathogens by the innate immune system. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2013] Transcript Variant: This variant (2) lacks an alternate coding exon and has an alternate splice site in the 3' region, compared to variant 1. The resulting isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236606 | CEACAM3 (myc-DDK-tagged) - Human carcinoembryonic antigen-related cell adhesion molecule 3 (CEACAM3), transcript variant 2 |
CNY 3990.00 |
|
RG236606 | CEACAM3 (tGFP-tagged) - Human carcinoembryonic antigen-related cell adhesion molecule 3 (CEACAM3), transcript variant 2 |
CNY 4370.00 |
其它CEACAM3产品