CD40 (NM_001302753) Human Untagged Clone
CAT#: SC334707
CD40 (untagged) - Human CD40 molecule, TNF receptor superfamily member 5 (CD40), transcript variant 3
CNY 2,640.00
CNY 2,950.00
货期*
现货
规格
Product images
经常一起买 (4)
CD40 mouse monoclonal antibody, clone OTI1F12 (formerly 1F12)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | Bp50; CDW40; p50; TNFRSF5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001302753, the custom clone sequence may differ by one or more nucleotides
ATGGTTCGTCTGCCTCTGCAGTGCGTCCTCTGGGGCTGCTTGCTGACCGCTGTCCATCCAGAACCACCCA CTGCATGCAGAGAAAAACAGTACCTAATAAACAGTCAGTGCTGTTCTTTGTGCCAGCCAGGACAGAAACT GGTGAGTGACTGCACAGAGTTCACTGAAACGGAATGCCTTCCTTGCGGTGAAAGCGAATTCCTAGACACC TGGAACAGAGAGACACACTGCCACCAGCACAAATACTGCGACCCCAACCTAGGGCTTCGGGTCCAGCAGA AGGGCACCTCAGAAACAGACACCATCTGCACCTGTGAAGAAGGCTGGCACTGTACGAGTGAGGCCTGTGA GAGCTGTGTCCTGCACCGCTCATGCTCGCCCGGCTTTGGGGTCAAGCAGATTGCTACAGGGGTTTCTGAT ACCATCTGCGAGCCCTGCCCAGTCGGCTTCTTCTCCAATGTGTCATCTGCTTTCGAAAAATGTCACCCTT GGACAAGCTGTGAGACCAAAGACCTGGTTGTGCAACAGGCAGGCACAAACAAGACTGATGTTGTCTGTGG TGAGTCCTGGACAATGGGCCCTGGAGAAAGCCTAGGAAGGTCCCCAGGATCGGCTGAGAGCCCTGGTGGT GATCCCCATCATCTTCGGGATCCTGTTTGCCATCCTCTTGGTGCTGGTCTTTATCAAAAAGGTGGCCAAG AAGCCAACCAATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001302753 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001302753.1, NP_001289682.1 |
RefSeq Size | 1669 bp |
RefSeq ORF | 714 bp |
Locus ID | 958 |
UniProt ID | P25942 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Protein Pathways | Allograft rejection, Asthma, Autoimmune thyroid disease, Cell adhesion molecules (CAMs), Cytokine-cytokine receptor interaction, Primary immunodeficiency, Systemic lupus erythematosus, Toll-like receptor signaling pathway, Viral myocarditis |
Gene Summary | This gene is a member of the TNF-receptor superfamily. The encoded protein is a receptor on antigen-presenting cells of the immune system and is essential for mediating a broad variety of immune and inflammatory responses including T cell-dependent immunoglobulin class switching, memory B cell development, and germinal center formation. AT-hook transcription factor AKNA is reported to coordinately regulate the expression of this receptor and its ligand, which may be important for homotypic cell interactions. Adaptor protein TNFR2 interacts with this receptor and serves as a mediator of the signal transduction. The interaction of this receptor and its ligand is found to be necessary for amyloid-beta-induced microglial activation, and thus is thought to be an early event in Alzheimer disease pathogenesis. Mutations affecting this gene are the cause of autosomal recessive hyper-IgM immunodeficiency type 3 (HIGM3). Multiple alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Nov 2014] Transcript Variant: This variant (3) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform 3, which has a shorter and distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...