beta V Tubulin (TUBB) (NM_001293213) Human Untagged Clone

CAT#: SC334761

TUBB (untagged) - Human tubulin, beta class I (TUBB), transcript variant 3



  "NM_001293213" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit polyclonal anti-TUBB(beta Tubulin) antibody, Loading control
    • 100 ul

CNY 5521.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CDCBM6; CSCSC1; M40; OK/SW-cl.56; TUBB1; TUBB5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001293213, the custom clone sequence may differ by one or more nucleotides


ATGAGGGAAATCGTGCACATCCAGGCTGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGA
TCAGTGATGAACATGGCATCGACCCCACCGGCACCTACCACGGGGACAGCGACCTGCAGCTGGACCGCAT
CTCTGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCCATCCTGGTGGATCTAGAACCT
GGGACCATGGACTCTGTTCGCTCAGGTCCTTTTGGCCAGATCTTTAGACCAGACAACTTTGTATTTGGTC
AGTCTGGGGCAGGTAACAACTGGGCCAAAGGCCACTACACAGAGGGCGCCGAGCTGGTTGATTCTGTCCT
GGATGTGGTACGGAAGGAGGTCGATGAGCAGATGCTTAACGTGCAGAACAAGAACAGCAGCTACTTTGTG
GAATGGATCCCCAACAATGTCAAGACAGCCGTCTGTGACATCCCACCTCGTGGCCTCAAGATGGCAGTCA
CCTTCATTGGCAATAGCACAGCCATCCAGGAGCTCTTCAAGCGCATCTCGGAGCAGTTCACTGCCATGTT
CCGCCGGAAGGCCTTCCTCCACTGGTACACAGGCGAGGGCATGGACGAGATGGAGTTCACCGAGGCTGAG
AGCAACATGAACGACCTCGTCTCTGAGTATCAGCAGTACCAGGATGCCACCGCAGAAGAGGAGGAGGATT
TCGGTGAGGAGGCCGAAGAGGAGGCCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001293213
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001293213.1, NP_001280142.1
RefSeq Size 2082 bp
RefSeq ORF 729 bp
Locus ID 203068
UniProt ID P07437
Protein Families Druggable Genome
Protein Pathways Gap junction, Pathogenic Escherichia coli infection
Gene Summary This gene encodes a beta tubulin protein. This protein forms a dimer with alpha tubulin and acts as a structural component of microtubules. Mutations in this gene cause cortical dysplasia, complex, with other brain malformations 6. Alternative splicing results in multiple splice variants. There are multiple pseudogenes for this gene on chromosomes 1, 6, 7, 8, 9, and 13. [provided by RefSeq, Jun 2014]
Transcript Variant: This variant (3) has multiple differences, compared to variant 1. It initiates translation at an alternate start codon and lacks an in-frame portion of the 3' coding region. The encoded isoform (c) has a distinct N-terminus and is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...