FDFT1 (NM_001287756) Human Untagged Clone

CAT#: SC334822

FDFT1 (untagged) - Human farnesyl-diphosphate farnesyltransferase 1 (FDFT1), transcript variant 11



  "NM_001287756" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
FDFT1 mouse monoclonal antibody, clone OTI2F10 (formerly 2F10)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DGPT; ERG9; SQS; SQSD; SS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001287756, the custom clone sequence may differ by one or more nucleotides


ATGCCTTGGCCACCCCGAAGAGTTCTACAACCTGGTGCGCTTCCGGATCGGGGGCAAGCGGAAGCCTCAG
AGTTTGAAGACCCCTTAGTTGGTGAAGATACAGAACGTGCCAACTCTATGGGCCTGTTTCTGCAGAAAAC
AAACATCATCCGTGACTATCTGGAAGACCAGCAAGGAGGAAGAGAGTTCTGGCCTCAAGAGGTTTGGAGC
AGGTATGTTAAGAAGTTAGGGGATTTTGCTAAGCCGGAGAATATTGACTTGGCCGTGCAGTGCCTGAATG
AACTTATAACCAATGCACTGCACCACATCCCAGATGTCATCACCTACCTTTCGAGACTCAGAAACCAGAG
TGTGTTTAACTTCTGTGCTATTCCACAGGTGATGGCCATTGCCACTTTGGCTGCCTGTTATAATAACCAG
CAGGTGTTCAAAGGGGCAGTGAAGATTCGGAAAGGGCAAGCAGTGACCCTGATGATGGATGCCACCAATA
TGCCAGCTGTCAAAGCCATCATATATCAGTATATGGAAGAGATTTATCATAGAATCCCCGACTCAGACCC
ATCTTCTAGCAAAACAAGGCAGATCATCTCCACCATCCGGACGCAGAATCTTCCCAACTGTCAGCTGATT
TCCCGAAGCCACTACTCCCCCATCTACCTGTCGTTTGTCATGCTTTTGGCTGCCCTGAGCTGGCAGTACC
TGACCACTCTCTCCCAGGTAACAGAAGACTATGTTCAGACTGGAGAACACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001287756
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001287756.1, NP_001274685.1
RefSeq Size 1705 bp
RefSeq ORF 753 bp
Locus ID 2222
UniProt ID P37268
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Steroid biosynthesis
Gene Summary This gene encodes a membrane-associated enzyme located at a branch point in the mevalonate pathway. The encoded protein is the first specific enzyme in cholesterol biosynthesis, catalyzing the dimerization of two molecules of farnesyl diphosphate in a two-step reaction to form squalene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (11) differs at the 5' end, lacks several internal exons, uses alternate donor and acceptor splice sites, and initiates translation from an alternate start codon compared to variant 1. The resulting shorter isoform (5) has a distinct N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...