RFC2 (NM_001278792) Human Untagged Clone

CAT#: SC334830

RFC2 (untagged) - Human replication factor C (activator 1) 2, 40kDa (RFC2), transcript variant 4



  "NM_001278792" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
RFC2 mouse monoclonal antibody, clone OTI3A7 (formerly 3A7)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RFC40
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278792, the custom clone sequence may differ by one or more nucleotides


ATGTGCCCAACATCATCATTGCGGGGCATTGACGTTGTGAGGAATAAAATTAAAATGTTTGCTCAACAAA
AAGTCACTCTTCCCAAAGGCCGACATAAGATCATCATTCTGGATGAAGCAGACAGCATGACCGACGGAGC
CCAGCAAGCCTTGAGGAGAACCATGGAAATCTACTCTAAAACCACTCGCTTCGCCCTTGCTTGTAATGCT
TCGGATAAGATCATCGAGCCCATTCAGTCCCGCTGTGCAGTCCTCCGGTACACAAAGCTGACCGACGCCC
AGATCCTCACCAGGCTGATGAATGTTATCGAGAAGGAGAGGGTACCCTACACTGATGACGGCCTAGAAGC
CATCATCTTCACGGCCCAGGGAGACATGAGGCAGGCGCTGAACAACCTGCAGTCCACCTTCTCAGGATTT
GGCTTCATTAACAGTGAGAACGTGTTCAAGGTCTGTGACGAGCCCCACCCACTGCTGGTAAAGGAGATGA
TCCAGCACTGTGTGAATGCCAACATTGACGAAGCCTACAAGATTCTTGCTCACTTGTGGCATCTGGGCTA
CTCACCAGAAGATATCATTGGCAACATCTTTCGAGTGTGTAAAACTTTCCAAATGGCAGAATACCTGAAA
CTGGAGTTTATCAAGGAAATTGGATACACTCACATGAAAATAGCGGAAGGAGTGAACTCTCTTTTGCAGA
TGGCAGGCCTCCTGGCAAGGCTGTGTCAGAAGACAATGGCCCCGGTGGCCAGTTAG


Restriction Sites SgfI-MluI     
ACCN NM_001278792
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278792.1, NP_001265721.1
RefSeq Size 1652 bp
RefSeq ORF 756 bp
Locus ID 5982
UniProt ID P35250
Protein Families Druggable Genome, Stem cell - Pluripotency
Protein Pathways DNA replication, Mismatch repair, Nucleotide excision repair
Gene Summary This gene encodes a member of the activator 1 small subunits family. The elongation of primed DNA templates by DNA polymerase delta and epsilon requires the action of the accessory proteins, proliferating cell nuclear antigen (PCNA) and replication factor C (RFC). Replication factor C, also called activator 1, is a protein complex consisting of five distinct subunits. This gene encodes the 40 kD subunit, which has been shown to be responsible for binding ATP and may help promote cell survival. Disruption of this gene is associated with Williams syndrome. Alternatively spliced transcript variants encoding distinct isoforms have been described. A pseudogene of this gene has been defined on chromosome 2. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (4) lacks an exon in the central coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (4) has a shorter and distinct N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...