CD48 (NM_001256030) Human Untagged Clone
CAT#: SC334841
CD48 (untagged) - Human CD48 molecule (CD48), transcript variant 2
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BCM1; BLAST; BLAST1; hCD48; mCD48; MEM-102; SLAMF2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001256030, the custom clone sequence may differ by one or more nucleotides
ATGTGCTCCAGAGGTTGGGATTCGTGTCTGGCTCTGGAATTGCTACTGCTGCCTCTGTCACTCCTGGTGA CCAGCATTCAAGGTCACTTGGTACATATGACCGTGGTCTCCGGCAGCAACGTGACTCTGAACATCTCTGA GAGCCTGCCTGAGAACTACAAACAACTAACCTGGTTTTATACTTTCGACCAGAAGATTGTAGAATGGGAT TCCAGAAAATCTAAGTACTTTGAATCCAAATTTAAAGGCAGGGTCAGACTTGATCCTCAGAGTGGCGCAC TGTACATCTCTAAGGTCCAGAAAGAGGACAACAGCACCTACATCATGAGGGTGTTGAAAAAGACTGGGAA TGAGCAAGAATGGAAGATCAAGCTGCAAGTGCTTGACCCTGTACCCAAGCCTGTCATCAAAATTGAGAAG ATAGAAGACATGGATGACAACTGTTATCTGAAACTGTCATGTGTGATACCTGGCGAGTCTGTAAACTACA CCTGGTATGGGGACAAAAGGCCCTTCCCAAAGGAGCTCCAGAACAGTGTGCTTGAAACCACCCTTATGCC ACATAATTACTCCAGGTGTTATACTTGCCAAGTCAGCAATTCTGTGAGCAGCAAGAATGGCACGGTCTGC CTCAGTCCACCCTGTACCCTGGGTAAGAAGGATCCCTGGGAGCTGAGGGGGGCACAGGGTAACTGGAGTT GTTTTGAACAAAGAAAGGCTGGGGGTCCTATTCAGCCTCCTTGCACAGTGTGGTGGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001256030 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001256030.1, NP_001242959.1 |
RefSeq Size | 1537 bp |
RefSeq ORF | 759 bp |
Locus ID | 962 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Natural killer cell mediated cytotoxicity |
Gene Summary | This gene encodes a member of the CD2 subfamily of immunoglobulin-like receptors which includes SLAM (signaling lymphocyte activation molecules) proteins. The encoded protein is found on the surface of lymphocytes and other immune cells, dendritic cells and endothelial cells, and participates in activation and differentiation pathways in these cells. The encoded protein does not have a transmembrane domain, however, but is held at the cell surface by a GPI anchor via a C-terminal domain which maybe cleaved to yield a soluble form of the receptor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (2) differs in the 3' UTR and coding region compared to variant 1. The resulting protein (isoform 2) is longer and has a distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...