KCTD20 (NM_001286579) Human Untagged Clone
CAT#: SC334857
KCTD20 (untagged) - Human potassium channel tetramerization domain containing 20 (KCTD20), transcript variant 2
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C6orf69; dJ108K11.3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001286579, the custom clone sequence may differ by one or more nucleotides
ATGAATGTTCACCGTGGCAGTGACAGTGACAGGTTATTGCGGCAGGAGGCCAGCTGCTTAGTGGATGATA CTTTAGCTGTAGCCCAAGAAAAAGAAGCAAACAGCCTGGCTTCATCTGGTCCTCATAATCTTACTTATCC TCTAGGTCCCAGGAATGAAGGTGCTTTACTCCATGAACTGTCTAATGACGGTGCTCATAAGCAGTTTGAT CACTACCTCGAAGAGCTCATCTTGCCCATCATGGTGGGCTGTGCCAAGAAAGGAGAACGAGAGTGCCACA TTGTTGTGCTGACGGATGAGGATTCTGTGGACTGGGATGAAGACCACCCTCCACCAATGGGGGAGGAATA TTCCCAAATTCTTTATAGCTCCAAGCTCTACAGATTCTTCAAATATATTGAGAATAGGGATGTTGCAAAA ACAGTGTTAAAGGAACGGGGCCTAAAAAACATTCGCATTGGAATTGAAGGTTACCCTACCTGTAAAGAAA AAATTAAGAGAAGGCCTGGCGGCCGGTCTGAAGTCATCTATAATTATGTACAACGCCCCTTCATCCAGAT GTCATGGGAAAAGGAAGAAGGGAAGAGTCGCCATGTGGATTTCCAGTGTGTTCGAAGCAAATCCCTCACG AATCTGGTAGCTGCTGGAGATGATGTCTTGGAGGACCAGGAGATATTAATGCATCACCCACCCCAAGTGG ATGAACTTGACCGGCTAAATGCCCCACTTTCTCAGATGGCTTCTAACGACTTTCAGGATTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001286579 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001286579.1, NP_001273508.1 |
RefSeq Size | 5145 bp |
RefSeq ORF | 762 bp |
Locus ID | 222658 |
UniProt ID | Q7Z5Y7 |
Protein Families | Druggable Genome, Ion Channels: Other |
Gene Summary | Promotes the phosphorylation of AKT family members.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks three alternate exons, resulting in the loss of an in-frame segment in the 5' coding region, compared to variant 1. The encoded isoform (b) is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236963 | KCTD20 (myc-DDK-tagged) - Human potassium channel tetramerization domain containing 20 (KCTD20), transcript variant 2 |
CNY 3990.00 |
|
RG236963 | KCTD20 (tGFP-tagged) - Human potassium channel tetramerization domain containing 20 (KCTD20), transcript variant 2 |
CNY 4370.00 |