GRAP2 (NM_001291826) Human Untagged Clone
CAT#: SC334883
GRAP2 (untagged) - Human GRB2-related adaptor protein 2 (GRAP2), transcript variant 4
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
GRAP2 mouse monoclonal antibody, clone OTI1G2 (formerly 1G2)
CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GADS; GRAP-2; GRB2L; GRBLG; GrbX; Grf40; GRID; GRPL; Mona; P38 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001291826, the custom clone sequence may differ by one or more nucleotides
ATGGGCAAGGAGGTTGGCTTCTTCATCATCCGGGCCAGCCAGAGCTCCCCAGGGGACTTCTCCATCTCTG TCAGGCATGAGGATGACGTTCAACACTTCAAGGTCATGCGAGACAACAAGGGTAATTACTTTCTGTGGAC TGAGAAGTTTCCATCCCTAAATAAGCTGGTAGACTACTACAGGACAAATTCCATCTCCAGACAGAAGCAG ATCTTCCTTAGAGACAGAACCCGAGAAGACCAGGGTCACCGGGGCAACAGCCTGGACCGGAGGTCCCAGG GAGGCCCACACCTCAGTGGGGCTGTGGGAGAAGAAATCCGACCTTCGATGAACCGGAAGCTGTCGGATCA CCCCCCGACCCTTCCCCTGCAGCAGCACCAGCACCAGCCACAGCCTCCGCAATATGCCCCAGCGCCCCAG CAGCTGCAGCAGCCCCCACAGCAGCGATATCTGCAGCACCACCATTTCCACCAGGAACGCCGAGGAGGCA GCCTTGACATAAATGATGGGCATTGTGGCACCGGCTTGGGCAGTGAAATGAATGCGGCCCTCATGCATCG GAGACACACAGACCCAGTGCAGCTCCAGGCGGCAGGGCGAGTGCGGTGGGCCCGGGCGCTGTATGACTTT GAGGCCCTGGAGGATGACGAGCTGGGGTTCCACAGCGGGGAGGTGGTGGAGGTCCTGGATAGCTCCAACC CATCCTGGTGGACCGGCCGCCTGCACAACAAGCTGGGCCTCTTCCCTGCCAACTACGTGGCACCCATGAC CCGATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001291826 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001291826.1, NP_001278755.1 |
RefSeq Size | 3436 bp |
RefSeq ORF | 777 bp |
Locus ID | 9402 |
Protein Families | Druggable Genome |
Protein Pathways | T cell receptor signaling pathway |
Gene Summary | This gene encodes a member of the GRB2/Sem5/Drk family. This member is an adaptor-like protein involved in leukocyte-specific protein-tyrosine kinase signaling. Like its related family member, GRB2-related adaptor protein (GRAP), this protein contains an SH2 domain flanked by two SH3 domains. This protein interacts with other proteins, such as GRB2-associated binding protein 1 (GAB1) and the SLP-76 leukocyte protein (LCP2), through its SH3 domains. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Apr 2014] Transcript Variant: This variant (4) lacks an internal exon, which results in a downstream start codon, compared to variant 1. The resulting isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...