AIPL1 (NM_001285403) Human Untagged Clone
CAT#: SC334906
AIPL1 (untagged) - Human aryl hydrocarbon receptor interacting protein-like 1 (AIPL1), transcript variant 8
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
AIPL1 mouse monoclonal antibody, clone OTI3B4 (formerly 3B4)
CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AIPL2; LCA4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001285403, the custom clone sequence may differ by one or more nucleotides
ATGGATGCCGCTCTGCTCCTGAACGTGGAAGGGGTCAAGAAAACCATTCTGCACGGGGGCACGGGCGAGC TCCCAAACTTCATCACCGGATCCCGAGTGATCTTTCATTTCCGCACCATGAAATGTGATGAGGAGCGGAC AGTCATTGACGACAGTCGGCAGGTGGGCCAGCCCATGCACATCATCATCGGAAACATGTTCAAGCTCGAG GTCTGGGAGATCCTGCTTACCTCCATGCGGGTGCACGAGGTGGCCGAGTTCTGGTGCGACACCATCCACA CGGGGGTCTACCCCATCCTATCCCGGAGCCTGAGGCAGATGGCCCAGGGCAAGGACCCCACAGAGTGGCA CGTGCACACGTGCGGGCTGGCCAACATGTTCGCCTACCACACGCTGGGCTACGAGGACCTGGACGAGCTG CAGAAGGAGCCTCAGCCTCTGGTCTTTGTGATCGAGCTGCTGCAGAGGGAGACCTGGAACCTGAGCAATC ATGAGAAGATGAAGGCGGTGCCCGTCCTCCACGGAGAGGGAAATCGGCTCTTCAAGCTGGGCCGCTACGA GGAGGCCTCTTCCAAGTACCAGGAGGCCATCATCTGCCTAAGGAACCTGCAGACCAAGGAGAAGCCATGG GAGGTGCAGTGGCTGAAGCTGGAGAAGATGATCAATACTCTGATCCTCAACTACTGCCAGTGCCTGCTGA AGAAGGAGGAGTACTATGAGGTGCTGGAGCACACCAGTGATATTCTCCGGCACCACCCAGGTGCGCGGGG CTGCAGGGGCGGACAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001285403 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001285403.2, NP_001272332.1 |
RefSeq Size | 1418 bp |
RefSeq ORF | 789 bp |
Locus ID | 23746 |
UniProt ID | Q9NZN9 |
Protein Families | Druggable Genome |
Gene Summary | Leber congenital amaurosis (LCA) is the most severe inherited retinopathy with the earliest age of onset and accounts for at least 5% of all inherited retinal diseases. Affected individuals are diagnosed at birth or in the first few months of life with nystagmus, severely impaired vision or blindness and an abnormal or flat electroretinogram. The photoreceptor/pineal-expressed gene, AIPL1, encoding aryl-hydrocarbon interacting protein-like 1, is located within the LCA4 candidate region. The encoded protein contains three tetratricopeptide motifs, consistent with chaperone or nuclear transport activity. Mutations in this gene may cause approximately 20% of recessive LCA. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014] Transcript Variant: This variant (8) uses an alternate splice site in the 5' coding region and represents an alternate 3' UTR, compared to variant 1. The resulting protein (isoform 8) is shorter, compared to variant 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
Customer
Reviews
Loading...