MKRN1 (NM_001291663) Human Untagged Clone

CAT#: SC334925

MKRN1 (untagged) - Human makorin ring finger protein 1 (MKRN1), transcript variant 3



  "NM_001291663" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
MKRN1 mouse monoclonal antibody, clone OTI2C8 (formerly 2C8)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RNF61
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001291663, the custom clone sequence may differ by one or more nucleotides


ATGCATGGGGTTTGTAAGGAAGGAGACAACTGTCGCTACTCGCATGACCTCTCTGACAGTCCGTATAGTG
TAGTGTGCAAGTATTTTCAGCGAGGGTACTGTATTTATGGAGACCGCTGCAGATATGAACATAGCAAACC
ATTGAAACAGGAAGAAGCAACTGCTACAGAGCTAACTACAAAGTCATCCCTTGCTGCTTCCTCAAGTCTC
TCATCGATAGTTGGACCACTTGTTGAAATGAATACAGGCGAAGCTGAGTCAAGAAATTCAAACTTTGCAA
CTGTAGGAGCAGGTTCAGAGGACTGGGTGAATGCTATTGAGTTTGTTCCTGGGCAACCCTACTGTGGCCG
TACTGCGCCTTCCTGCACTGAAGCACCCCTGCAGGGCTCAGTGACCAAGGAAGAATCAGAGAAAGAGCAA
ACCGCCGTGGAGACAAAGAAGCAGCTGTGCCCCTATGCTGCAGTGGGAGAGTGCCGATACGGGGAGAACT
GTGTGTATCTCCACGGAGATTCTTGTGACATGTGTGGGCTGCAGGTCCTGCATCCAATGGATGCTGCCCA
GAGATCGCAGCATATCAAATCGTGCATTGAGGCCCATGAGAAGGACATGGAGCTCTCATTTGCCGTGCAG
CGCAGCAAGGACATGGTGTGTGGGATCTGCATGGAGGTGGTCTATGAGAAAGCCAACCCCAGTGAGCGCC
GCTTCGGGATCCTCTCCAACTGCAACCACACCTACTGTCTCAAGTGCATTCGCAAGTGGAGGAGTGCTAA
GCAATTTGAGAGCAAGATCATAAAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001291663
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001291663.1, NP_001278592.1
RefSeq Size 1848 bp
RefSeq ORF 798 bp
Locus ID 23608
Protein Families Druggable Genome
Gene Summary This gene encodes a protein that belongs to a novel class of zinc finger proteins. The encoded protein functions as a transcriptional co-regulator, and as an E3 ubiquitin ligase that promotes the ubiquitination and proteasomal degradation of target proteins. The protein encoded by this gene is thought to regulate RNA polymerase II-catalyzed transcription. Substrates for this protein's E3 ubiquitin ligase activity include the capsid protein of the West Nile virus and the catalytic subunit of the telomerase ribonucleoprotein. This protein controls cell cycle arrest and apoptosis by regulating p21, a cell cycle regulator, and the tumor suppressor protein p53. Pseudogenes of this gene are present on chromosomes 1, 3, 9, 12 and 20, and on the X chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]
Transcript Variant: This variant (3) has multiple differences compared to variant 1. These differences result in distinct 5' and 3' UTRs and cause translation initiation at a downstream start codon compared to variant 1. The 5'-most initiation codon, as used in variant 1, is associated with a truncated ORF that would render the transcript a candidate for nonsense-mediated decay (NMD). Leaky scanning may allow translation initiation at the downstream AUG to encode an isoform (3) that has a shorter N-terminus, and a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...