POLR3F (NM_001282526) Human Untagged Clone

CAT#: SC334983

POLR3F (untagged) - Human polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa (POLR3F), transcript variant 2



  "NM_001282526" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


POLR3F rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C34; RPC6; RPC39
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282526, the custom clone sequence may differ by one or more nucleotides


ATGCCTCATATAGAAGCCCAGCAGCGGGCAGTAGCCATCAATAGGTTGTTGTCTATGGGTCAGTTGGATC
TCTTAAGGAGCAATACGGGCCTTTTATATAGAATAAAGGACTCTCAGAATGCTGGTAAAATGAAGGGATC
CGATAACCAAGAAAAACTAGTATATCAAATCATAGAGGATGCAGGAAATAAAGGAATATGGAGCAGAGAT
ATCCGCTATAAAAGTAATTTGCCATTAACAGAAATCAACAAAATTCTGAAGAATCTGGAAAGTAAAAAGC
TTATCAAAGCTGTTAAGTCTGTAGCAGCCTCAAAAAAGAAGGTGTATATGCTCTATAACCTGCAGCCAGA
CCGGTCTGTGACTGGTGGAGCCTGGTACAGTGACCAGGATTTTGAATCTGAATTTGTAGAGGTGCTTAAC
CAACAGTGTTTTAAATTCCTACAGTCCAAGGCAGAAACAGCACGAGAAAGCAAACAGAACCCAATGATAC
AAAGAAATAGTTCATTTGCCTCATCACATGAAGTGTGGAAATATATCTGCGAATTGGGAATCAGTAAGGT
AGAGTTATCCATGGAAGACATTGAAACCATCCTGAATACACTCATTTATGATGGAAAAGTGGAGATGACG
ATTATTGCTGCAAAAGAAGGCACAGTTGGCAGTGTAGATGGACACATGAAACTGTACAGGGCAGTCAATC
CAATCATCCCTCCCACAGGTTTGGTCCGGGCACCCTGTGGACTCTGCCCGGTTTTTGATGACTGCCACGA
AGGTGGTGAGATTTCACCATCTAACTGTATTTACATGACAGAGTGGCTCGAATTTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001282526
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282526.1, NP_001269455.1
RefSeq Size 2262 bp
RefSeq ORF 828 bp
Locus ID 10621
UniProt ID Q9H1D9
Protein Families Transcription Factors
Protein Pathways Cytosolic DNA-sensing pathway, Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase
Gene Summary The protein encoded by this gene is one of more than a dozen subunits forming eukaryotic RNA polymerase III (RNA Pol III), which transcribes 5S ribosomal RNA and tRNA genes. This protein has been shown to bind both TFIIIB90 and TBP, two subunits of RNA polymerase III transcription initiation factor IIIB (TFIIIB). Unlike most of the other RNA Pol III subunits, the encoded protein is unique to this polymerase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Transcript Variant: This variant (2) differs in its 5' UTR and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...