TGIF (TGIF1) (NM_001278682) Human Untagged Clone

CAT#: SC334985

TGIF1 (untagged) - Human TGFB-induced factor homeobox 1 (TGIF1), transcript variant 9



  "NM_001278682" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TGIF1 mouse monoclonal antibody, clone OTI1B12 (formerly 1B12)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HPE4; TGIF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278682, the custom clone sequence may differ by one or more nucleotides


ATGGCAGCCGCGCATTCTGGAAGAAGTATTGTTGCAGCATCTGGCAGTGAGACTGAGGATGAGGACAGCA
TGGACATTCCCTTGGACCTTTCTTCATCCGCTGGCTCAGGCAAGAGAAGGAGAAGGGGCAACCTACCCAA
GGAGTCTGTGCAGATTCTTCGGGATTGGCTGTATGAGCACCGTTACAATGCCTATCCTTCAGAGCAAGAA
AAAGCGTTGCTGTCCCAGCAAACACACCTGTCTACGCTACAGGTCTGTAACTGGTTCATCAACGCCCGCC
GCAGGCTCCTCCCTGACATGCTGAGAAAGGATGGCAAAGATCCAAATCAGTTCACAATTTCCCGCCGTGG
GGCCAAGATTTCTGAAACGAGCTCTGTGGAGTCCGTGATGGGCATCAAAAACTTCATGCCAGCTCTAGAG
GAGACCCCATTTCATTCCTGTACAGCTGGGCCAAACCCAACCCTAGGGAGGCCACTGTCTCCTAAGCCGT
CATCCCCGGGATCAGTTTTGGCTCGTCCATCAGTGATCTGCCATACCACTGTGACTGCATTGAAAGATGT
CCCTTTCTCTCTCTGCCAGTCGGTCGGTGTGGGACAAAACACAGATATACAGCAGATAGCGGCCAAAAAC
TTCACAGACACCTCTCTCATGTACCCAGAGGACACTTGTAAATCTGGACCAAGTACGAATACACAGAGTG
GTCTTTTCAACACTCCTCCCCCTACTCCACCGGACCTCAACCAGGACTTCAGTGGATTTCAGCTTCTAGT
GGATGTTGCACTCAAACGGGCTGCAGAGATGGAGCTTCAGGCAAAACTTACAGCTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001278682
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278682.1, NP_001265611.1
RefSeq Size 1530 bp
RefSeq ORF 828 bp
Locus ID 7050
UniProt ID Q15583
Protein Families Druggable Genome, Stem cell - Pluripotency, Stem cell relevant signaling - TGFb/BMP signaling pathway, Transcription Factors
Gene Summary The protein encoded by this gene is a member of the three-amino acid loop extension (TALE) superclass of atypical homeodomains. TALE homeobox proteins are highly conserved transcription regulators. This particular homeodomain binds to a previously characterized retinoid X receptor responsive element from the cellular retinol-binding protein II promoter. In addition to its role in inhibiting 9-cis-retinoic acid-dependent RXR alpha transcription activation of the retinoic acid responsive element, the protein is an active transcriptional co-repressor of SMAD2 and may participate in the transmission of nuclear signals during development and in the adult. Mutations in this gene are associated with holoprosencephaly type 4, which is a structural anomaly of the brain. Alternative splicing has been observed at this locus and multiple splice variants encoding distinct isoforms are described. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (9) has an alternate 5' terminal exon, which results in a different 5' UTR and 5' coding region, compared to variant 1. The resulting isoform (e) is shorter and has a distinct N-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...