Lysosomal acid lipase (LIPA) (NM_001288979) Human Untagged Clone

CAT#: SC335055

LIPA (untagged) - Human lipase A, lysosomal acid, cholesterol esterase (LIPA), transcript variant 3



  "NM_001288979" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Lipase A Antibody
    • 100 ul

CNY 5381.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CESD; LAL
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001288979, the custom clone sequence may differ by one or more nucleotides


ATGGGCAACAGCAGAGGAAATACCTGGTCTCGGAAACATAAGACACTCTCAGTTTCTCAGGATGAATTCT
GGGCTTTCAGTTATGATGAGATGGCAAAATATGACCTACCAGCTTCCATTAACTTCATTCTGAATAAAAC
TGGCCAAGAACAAGTGTATTATGTGGGTCATTCTCAAGGCACCACTATAGGTTTTATAGCATTTTCACAG
ATCCCTGAGCTGGCTAAAAGGATTAAAATGTTTTTTGCCCTGGGTCCTGTGGCTTCCGTCGCCTTCTGTA
CTAGCCCTATGGCCAAATTAGGACGATTACCAGATCATCTCATTAAGGACTTATTTGGAGACAAAGAATT
TCTTCCCCAGAGTGCGTTTTTGAAGTGGCTGGGTACCCACGTTTGCACTCATGTCATACTGAAGGAGCTC
TGTGGAAATCTCTGTTTTCTTCTGTGTGGATTTAATGAGAGAAATTTAAATATGTCTAGAGTGGATGTAT
ATACAACACATTCTCCTGCTGGAACTTCTGTGCAAAACATGTTACACTGGAGCCAGGCTGTTAAATTCCA
AAAGTTTCAAGCCTTTGACTGGGGAAGCAGTGCCAAGAATTATTTTCATTACAACCAGAGTTATCCTCCC
ACATACAATGTGAAGGACATGCTTGTGCCGACTGCAGTCTGGAGCGGGGGTCACGACTGGCTTGCAGATG
TCTACGACGTCAATATCTTACTGACTCAGATCACCAACTTGGTGTTCCATGAGAGCATTCCGGAATGGGA
GCATCTTGACTTCATTTGGGGCCTGGATGCCCCTTGGAGGCTTTATAATAAAATTATTAATCTAATGAGG
AAATATCAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001288979
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001288979.1, NP_001275908.1
RefSeq Size 2545 bp
RefSeq ORF 852 bp
Locus ID 3988
UniProt ID P38571
Protein Families Druggable Genome
Protein Pathways Lysosome, Steroid biosynthesis
Gene Summary This gene encodes lipase A, the lysosomal acid lipase (also known as cholesterol ester hydrolase). This enzyme functions in the lysosome to catalyze the hydrolysis of cholesteryl esters and triglycerides. Mutations in this gene can result in Wolman disease and cholesteryl ester storage disease. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (3) lacks two consecutive exons in the 5' region, which results in translation initiation at a downstream AUG, compared to variant 1. The resulting isoform (2) has a shorter N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...